Question: Which statement is FALSE about the genetic code? a . the Code contains 6 4 codons c . each amino acid has only one codon

Which statement is FALSE about the genetic code?
a. the Code contains 64 codons
c. each amino acid has only one codon
b. the Code has 1 start and 3 stop codons
d. a codon is composed of three bases
Which statement is FALSE about the genetic code?

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

Which of the following statements about the genetic code iscorrect? All codons specify more than one amino acid. The genetic code is redundant. All amino acids are specified by more than one codon....

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

The DNA molecule is made up of two linked strands which together form a helix. The links between the strands are provided by bonds between pairs of chemicals called bases . There are four such bases,...

Q:

in python please ! a string consisting purely of nucleotides by first removing the in and then all the newline characters. You'll need to do the following to find all the occurrences of the...

Q:

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txt and ecoli.txt from below. Save these files in the same folder...

Q:

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txtand ecoli.txtfrom below. Save these files in the same folder...

Q:

C++ Your assignment is to build an application that can read a file of nucleotides into a linked list. 1. The file contains a sequence of nucleotides (G, C, A, T). 2. The file will always contain a...

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

Java dna1.txt 10 cure for cancer protein ATGCCACTATGGTAG captain sisko leadership protein ATgCCAACATGgATGCCcGATAtGGATTgA Ada Lovelace non protein CCATt-AATgATCa-CAGTt michael phelps protein...

Q:

You have been hired by a genome lab to write a java program that will read in information from a text file and produce specific results to the screen and an output file. Concepts Arrays of objects...

Q:

Case Study Your clients, George and Jane Jetson, have come to you for assistance with their financial plan. They provide you with the following information: George (age 44) Earns $104,000 annually...

Q:

For each of the following categories, state concisely a transaction that will have the required effect on the elements of the accounting equation. (a). Increase an asset and increase a liability....

Q:

Fill in the blank question. Capital is a general term that refers to any shares issued to obtain capital (owner financing)

Q:

??????? Transaction Analysis and Adjustments Mark Ladd opened Ladd Roofing Service on April 1. The unadjusted account balances as of April 30 are as follows: a. Using the Transaction Analysis...