Question: Why are the gene-flanking sequences necessary for mutating or deleting a gene by homologous recombination? A. They allow homologous recombination to swap the DNA between

Why are the gene-flanking sequences necessary for mutating or deleting a gene by homologous recombination? A. They allow homologous recombination to swap the DNA between the flanking sequences B. They activate DNA repair by non-homologous end-joining C. They protect the DNA between the flanking sequences from exonucleases

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Sections 10.1 and 10.2 Reading Assignment: Sequences and Series Answer Only Exercise 1, 2, and 3 by using a screenshot provided Calculus Pearson textbook. Make sure you read these three questions...

Question 6-7 please, and according to chegg terms it is allowed as they are both apart of the deck of cards question Please answer in C++ DECK OF CARDS The standard 52-card deck of French-suited...

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

4:44 Lab 2 o Post Lab Questions: Name ID# 1. Create a Perl Script that will translate the following DNA sequence (ATGCTGACCATTTTCTTTTCCTCCACTGAAGCA) into the 6 possible amino acid sequences (that...

Problem Statement: This question asks to write a script to obtain all protein sequences coded in the human genome in the multiple FASTA format, using the RefSeq table obtained from the UCSC Table...

Pls write the full code C++ a. Create a class named Map which would be used to create the following: The actual Map of Mars, which is to be hidden from the user and will only be displayed to the user...

Here is the instruction I'm struggling with the last part of the question I keep failing on the here is my code : import java.util.*; import java.io.*; public class PlainSequences implements...

2 Part 2: Single Player Rummy Game with Dice and strange deck Description: A card in a standard deck has a suit (in particular, one of four suits: , , , ) and a rank (one of 13 ranks: A, 2, 3, ...,...

CSC 110 - Homework 9 - Bioinformatics We have seen the code in class that finds all alignments between a pair of sequences by adding gaps to the shorter sequence. You can find a version of that code...

Computational Phylogenetics Phylogenetics is the study of evolutionary history based on heritable traits such as DNA sequences. In computational phylogenetics (Links to an external site.)Links to an...

Jade is a 35-year-old unmarried resident of South Africa. She is employed on a full-time basis at CGI Ltd since 1 April of the current year. Jade earned the following amounts per month: A salary R18...

For the fiscal year, sales were $4,125,800, sales discounts were $380,000, sales returns and allowances were $186,750, and the cost of merchandise sold was $2,475,500. a. What was the amount of net...

estelle converted $ 3 , 0 0 0 into Dogecoin in October of 2 0 1 9 . On April 1 7 , 2 0 2 4 , she sold all her holdings for $ 1 , 7 5 5 and used the proceeds to purchase a set of golf clubs. How will...

Julian Birkinshaw, James Manktelow, Vittorio DAmato, Elena Tosca, and Francesca Macchi In recent years, one of the most profound transformations in the workplace has been the increase in age...