Write a bash script named codoncount that expects a file name on the command line. The file is a DNA file, that only contains DNA string with no newline characters or white space characters. The DNA is a sequences of a, c, g and t of length 3n for some n. The bash script must count the number of occurrences of every codon in file, first codon starts at position 1^2, and it must output the number of times each codon appears, sorted in order of decreasing frequency (if there is a tie in frequency it should be broken by sorting in alphabetical order). If it cannot read the file, it must exit with a message "cannot open file".

Ex: DNA string in file DNAfile: aacgtttgtaaccagaactgt, then command

./codoncount DNAfile

Produces this output

3 aac

2 tgt

1 cag

1 gtt