Question: Write a bash script that counts the number of G bases in the sequence below and prints the results to the screen. Exclude white spaces.

Write a bash script that counts the number of G bases in the sequence below and prints the results to the screen. Exclude white spaces. Answer should include code and output

Write a bash script that counts the number of G bases in

CTATGATAGGACATCTCTTGGAGACACCTATTAATGTTTCAGAAACGGATACCTTGGTTG TCCAGTACGAAATTAAGTTGGACAATTCTTTGACGTGCGGC CTATATTAAAATTGTGGGTACATCACTCTCTTACCTGAGAATTCCAACAGAGCAGGACGC

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Q:

1. The last command lists information about who has logged into the computer on which it is run. In particular, it has a column with the username, the terminal on which the user was connected, the...

Q:

Use the diagram of the sample Class File System directory tree to assist with this lab. Step 1. Open the terminal window Click Start->All Programs->PuTTY(64-bit) folder->PuTTY icon enter "ubuntu"...

Q:

Input: insert 0 DNA AATTCCGGAATTCCGG insert 2 RNA UAGACAUGGAUU insert 1 DNA ABCDE insert 1 RNA TTTT insert 4 DNA AATTCCGGAATTCCGG print remove 1 remove 4 print print 0 print 2 print 4 clip 0 0 7...

Q:

Programming is to practice how to think like a computer, so we can tell the computer what to do. Please always allocate enough time to think things over. Hit: Use meaningful variable names can help...

Q:

A discrete sequence {xn} can be converted into a continuous representation x(t) = ts X n= (t n ts) xn, where ts is the sampling period. (a) State two characteristic properties of Dirac's function. [2...

Q:

Design and implement functions that build an order K Markov model from a piece of input text. Markov models are popular tools in speech recognition, handwriting recognition, information retrieval,...

Q:

Briefly describe ASCII and Unicode and draw attention to any relationship between them. [3 marks] (b) Briefly explain what a Reader is in the context of reading characters from data. [3 marks] A...

Q:

Please provide full Java source code for the task along with step-by-step explanation. Using Java Design and implement functions that build an order K Markov model from a piece of input text. Markov...

Q:

: (i) What data structures are maintained by the page manager. (ii) What happens when a machine performs a read operation to a page. (iii) What happens when a machine performs a write operation to a...

Q:

llustrate different ways of connecting these components together to span a range of performance requirements. [10 marks] For each of the performance categories that you identify state today's typical...

Q:

Charles is a single person, age 35, with no dependents. In 2019, Charles has gross income of $75,000 from his sole proprietorship. Charles also incurs $80,000 of deductible business expenses in...

Q:

Solve the problem 0 0 Utt - Uzz = 0 u (r, 0) = u (r,0) = 0 u (0, t) = 1, u (1, t) = 0 %3D t2 0.

Q:

Sandhill Company estimates that variable costs will be 6 2 of sal es . and fixed cost will total 5 5 1 6 . 8 0 0 . The unit selling price of the product is $ 5 ( a ) Your Answer uarr Your answer cos...

Q:

which one of the following best describe the type of companies that are affected by globalization

Q:

Compare the Building Society job statement with a conventional job description. In what ways does it differ and how valuable might it prove for the employee?

Q:

How would you best sell the human resources function to the rest of the organisation?

Q:

Read the section on technology and draw up a list of advantages and disadvantages of using social media in the recruitment process.