Write a bash script that removes all white spaces or newline characters(like in the below example), and count the exact number of bases present. It's a large sequence and similar new line characters/ white spaces appear in other parts of the sequence, but the goal is to be able to count all the sequences without counting the white spaces as that inflates the count. Please write using bash script.

CTATGATAGGACATCTCTTGGAGACACCTATTAATGTTTCAGAAACGGATACCTTGGTTG TCCAGTACGAAATTAAGTTGGACAATTCTTTGACGTGCGGC CTATATTAAAATTGTGGGTACATCACTCTCTTACCTGAGAATTCCAACAGAGCAGGACGC