Question: Write a bit of Biopython code that will find the number of occurrences and locations of ACTT within the following sequence. Where are the matches

Write a bit of Biopython code that will find the number of occurrences and locations of ACTT within the following sequence. Where are the matches located? Please note that you must search the entire sequence, which is provided on two lines here:

 >sequence AGCGATCTAGCATACTTATACGCGCGCAGCTATCGATCACTTGTGCTAGTAAAGTGCGCGCCGCA TTAAAGTGCTAGCTAGCTACTTAGCTAGCTAGTCG

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Python and most Python libraries are free to download or use, though many users use Python through a paid service. Paid services help IT organizations manage the risks associated with the use of...

Hi I need help with this project that I am doing. It has to be in C language and I don't what to do. This is for my Data Structure course. Please it has to be in Language of C. Programming Assignment...

In C++ please. Assignment 4 This assignment is the first in a sequence of three. It is not strictly necessary to complete this one in order to do the other two, but the understanding you gain in...

Jones & Bartlett Learning, LLC. NOT FOR RESALE OR DISTRIBUTION CHAPTER Hot Spot Analysis 10 LEARNING OBJECTIVES C A R R Provide a working definition of a \"hot spot.\" , Be able to explain different...

Mates Rates Rent-A-Car ( just do the part a) using visual studio code (C#) Criteria sheet - Par A Example supplementary files (readme.pdf) Example supplementary files (class-diagram.pdf) Assignment...

Java Implementation Introduction This assignment is designed to provide you with a practical understanding of the task of writing an assembler You will write an assembler for a low-level language...

Write the python3 code for the following classes, given the classes & descriptions: Here's the code for these classes: https://repl.it/@AnonAnon6/NavybluePrettyConditions Please write the code for...

Give Correct ANSWERS Human-Computer Interaction (a) If you had been one of the original inventors of the WIMP interface, and engineers on the technical team had been sceptical about the advantages...

FIR 3303, Introduction to Fire Prevention Course Syllabus Course Description Fire Prevention provides fundamental knowledge relating to the field of fire prevention. Topics include the history and...

If the motor draws in the cable at a rate of v=(0.05t^2)m/s, where t is in seconds, determine the tension developed in the cable when t=2.5 s. the crate has a mass of 25 kg and the coefficient of...

A study in the New England Journal of Medicine compared cardiovascular events for treatments of low-dose aspirin or placebo among 39, 876 healthy female health care providers for an average duration...

The 5wheeler truck has loads that are concentrated on the wheel axles as shownAssume the truck can travel in either direction along the center of the deck so that half of its load is transferred to...

Edison is a doctor with a standard HO-1 policy with $450,000 worth of insurance on his home, an auto insurance policy with liability limits of 100/300/50, and an additional professional liability...

Technology. During the past few weeks, youve received manytoo manye-mails that contain chain letters, jokes, recipes, and other nonbusiness material. An occasional message of this nature is a nice...

Teamwork. Work with one other student. Exchange the messages you wrote in Exercise 7 and read them silently, then aloud.Discuss whether and how the tone you thought you used in your message...

Global. Technology. Access the home page of two companies based in countries other than the United States and two similar companies in the United States (e.g., financial institutions, airlines). In...