Write a MATLAB program that computes the dot matrix to find complementarity in the

following RNA sequence

Sequence: ACGUGCGACAUGAACGUAGCGUAGGCUA

Use the following scoring function to score for complementarity. $($ Wobble pair $=1)$

Complementarity $(i,j)=\{\begin{array}{ccc}i(& \text{c}\text{o}\text{m}\text{p}\text{l}\text{e}\text{m}\text{e}\text{n}\text{t}\text{s})j,& 2\\ i(!& \text{c}\text{o}\text{m}\text{p}\text{l}\text{e}\text{m}\text{e}\text{n}\text{t})j,& 0\end{array}$

Additionally, plot the frequency of complementary base pairs $($A$-$U$,$ G$-$C $,$U$-$A$,$ C$-$G etc.$)$

Note: no build in function share screenshot of answer and code after test run