Question: Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a

Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line. (3 Marks) The given program may have errors in it. Rewrite the full program without errors. (2 Marks) Program #include #include int main() int p=6;q=12; if((p

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line. (3 Marks) 1 B I 1 ? Write a program to display a city name,...

Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line. (3 Marks) Write a program to enter a number from the keyboard,...

Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line. (3 Marks) 2 A B I % 5 8

Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line. (3 Marks)

c program Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line

rite a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line. (3 Marks) Computer Programming For Engg +c

Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line.

Computer programming Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line

Question 16 Not yet answered Marked out of 3.00 Flag question Write a program to display a city name, country name and year entered by the user. Each one of them should be displayed in a new line

Explain how an equilibrium constant can be obtained from thermal data alone (that is, from measurements of heat only).

The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...

Question content area top Part 1 Which of the following is an example of an intangible asset? Question content area bottom Part 1 A . Plant B . Property C . Copyright D . Equipment

Scenario: A Multi-national Corporation called The Globe has created a subsidiary called Thirst in an under-developed country called non-potable waters. This hosting country suffers from a severe...

2. Why do people volunteer for non-profit-making organisations and what can these organisations do to ensure their volunteers are engaged?

4. What volunteering have you done and why did you volunteer? If you havent volunteered for anything, why havent you?

2. Explain the relationship between employee involvement, employee commitment, engagement and high-performance working.