Write python code on computer, No handwritten code

?et @D-??1m]. C HI c: ? ?>>? E XA.. ?? curerstycly Exam2.?? temp. 40 41 12" 1302: [20 points] Write python code that uses the above function to perform 1000 4 sequential mutations on dna sequence ACGGAGATTTCGGTATGCAT 15 Code should display fequencies of each letter before and after 1000 mutations. 16 17 Sample output should like this. The numbers may not be exactly the same 8Starting DNA: ACGGAGATTTCGGTATGCAT 19A: 0.25, C: 0.15, T: 0.30, G: 0.30 0 DNA after 10000 mutations: AACCAATCCGACGAGGAGTG 1A: 0.35, C: 0.25, T: 0.10, G: 0.30 3 dnaACGGAGATTTCGGTATGCAT 4 5