Question: write the inventory, formula and solve Centripetal Force 1. A 2.10 m rope attaches a tire to an overhanging tree limb. A girl swinging on

write the inventory, formula and solve

Centripetal Force 1. A 2.10 m rope attaches a tire to an overhanging tree limb. A girl swinging on the tire has a tangential speed of 2.50 m/s. If the magnitude of the centripetal force is 88.0 N, what is the girl's mass? 2. A bicyclist is riding at a tangential speed of 13.2 m/s around a circular track. The magnitude of the centripetal force is 377 N, and the combined mass of the bicycle and rider is 86.5 kg. What is the track's radius? 3. A dog sits 1.50 m from the center of a merry-go-round and revolves at a tangential speed of 1.80 m/s. If the dog's mass is 18.5 kg, what is the magnitude of the centripetal force on the dog? 4. A 905 kg car travels around a circular track with a circumference of 3.25 km. If the magnitude of the centripetal force is 2140 N, what is the car's tangential speed

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Physics Questions!

Entries into T accounts and Trial Balance Marjorie Knaus, an architect, organized Knaus Architects on January 1, 20Y4. During the month, Knaus Architects completed the following transactions: a....

show inventory formula and solution Centripetal Acceleration 1. A rope attaches a tire to an overhanging tree limb. A girl swinging on the tire has a centripetal acceleration of 3.0 m/s'. If the...

Centripetal Acceleration (continued) 1. A rope attaches a tire to an overhanging tree limb. A girl swinging on the tire has a centripetal acceleration of 3.0 m/sz. If the length of the rope is 2.1 m....

Questions: 1. To tighten a bolt, you push with a force of 100 Nat the end of the wrench handle that is 0.5 m from the axis of the bolt. (a) What torque are you exerting? (b) If you move your hand...

1. To tighten a bolt, you push with a force of 100 Nat the end of the wrench handle that is 0.5 m from the axis of the bolt. (a) What torque are you exerting? (b) If you move your hand inward to be...

The daily demand for the latest monitor at Millennium Computer Corp. follows a uniform distribution between 5 and 20. Millennium Computer purchases these minitors for $55 and sells them for $100. It...

Reference & Financial Functions Worksheet Name: _________________ Lab Day/Time: _____________ . Orders Inventory Warranty Types You own a small Computer Retailing company that sells computer systems....

So far in this excel class we've covered the basics of entering data in cells and creating charts. Now all of a sudden we have this assignment and are supposed to know how to do these things. I'm not...

XU PART 2- CU, Inc. (CU) produces copper contacts that it uses in switches and relays. CUI needs to determine the order quantity to meet the annual demand at the lowest cost. The price of copper...

8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5' A.) What is the MRNA sequence that would result from transcription of this sequence?...

The effectiveness of a barbiturate as a sedative is related to its ability to penetrate the nonpolar membrane of a cell. Which of the following barbiturates would you expect to be the more effective...

ClackBerfy sained slovifant market share in the early 2 0 0 0 s for its smartyhores. fuentally. The company lout market share when it falled to respond to other companies releasing sleeker...

Refer to Exercise 13-6. Assume that the company identifies poor plant layout as the root cause of wait time and move time. Required: 1. Express an improvement strategy as a series of if-then...

The Costello Music Company has been in business for five years. During that time, the sales of electric organs have grown from 12 units in the first year to 76 units in the most recent year. Fred...

The Federal Election Commission maintains data showing the voting age population, the number of registered voters, and the turnout for federal elections. The following table shows the national voter...

Sean Nah, the bookkeeper for Revell Co., received a bank statement from Lone Bank. Sean noticed a $250 mistake made by the bank in the company's favor. Sean called his supervisor, who said that as...

In 1987, Herman Moore Company completed the construction of a building at a cost of $2,000,000 and first occupied it in January 1988. It was estimated that the building will have a useful life of 40...

Write a 2 page paper about how market segmentation is beneficial to small and big companies.

3. Self-awareness is very important. As we get to know ourselves, we can identify barriers to acceptance by others. Once you have identified your most preferred communication style, you have taken a...

4. You have been given the opportunity to complete an online assessment of your communication style (see page 64). After completion of this assessment you were provided with a profile that indicates...

1. If Ms. Perez displays the characteristics of the Director communication style, how should Eric conduct himself during the meeting? Be specific as you analyze those behaviors that would be admired...