Write two C++ functions. 1. void Array::cleave(const std::string & target) {}

Remove from current array the sequence between the end of the first occurrence of a passed target sequence through the end of the second occurence of the target sequence

For example,

pre: Array e.g. ACTTGACCTTGA and target e.g. "TTG"

post: ACTTGA (ACCTTG removed)

 2. void Array::cleaveAll (const std::string & target) {}

Remove from current array the sequence between pairs of target sequence

For example,

pre: Array e.g. ACTTGATTGGGTTGCTTGCC and target e.g. "TTG"

post: ACTTGGGTTGCC (ATTG and CTTG removed)

Requirements: The array should be a character array instead of a cstring. Please don't turn it into a string object and directly manipulate the character array.