Question: write two programs to implement the two formulations of the problem of motif finding. summarize your work with the source code and the testing results

write two programs to implement the two formulations of the problem of motif finding.

summarize your work with the source code and the testing results for comparing the two formulations.

Running Format: C> a.out sequence.fasta output.txt

The format of the input fasta files: The following is an example to demonstrate the input format. >SEQUENCE_1 atgaccgggatactgatagaagaaaggttgggggcgtacacattagataaacgtatgaagtacgttagactcggcgccgccgacccctattttttgagc agatttagtgacctggaaaaaaaatttgagtacaaaacttttccgaatacaataaaacggcgggatgagtatccctgggatgacttaaaataatggagt ggtgctctcccgatttttgaatatgtaggatcattcgccagggtccga >SEQUENCE_2 gctgagaattggatgcaaaaaaagggattgtccacgcaatcgcgaaccaacgcggacccaaaggcaagaccgataaaggagatcccttttgcggtaat gtgccgggaggctggttacgtagggaagccctaacggacttaatataataaaggaagggcttataggtcaatcatgttcttgtgaatggatttaacaata agggctgggaccgcttggcgcacccaaattcagtgtgggcgagcgcaa >SEQUENCE_3 cggttttggcccttgttagaggcccccgtataaacaaggagggccaattatgagagagctaatctatcgcgtgcgtgttcataacttgagttaaaaaata gggagccctggggcacatacaagaggagtcttccttatcagttaatgctgtatgacactatgtattggcccattggctaaaagcccaacttgacaaatgg aagatagaatccttgcatactaaaaaggagcggaccgaaagggaag

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

Discrete structure MAC281 Discrete Structures Project (Integrative learning, written) Goal: The main goal of the project is to let students use their prior knowledge, try to use the skills they have...

subject: Discrete structu Project Goal: The main goal of the project is to let students use their prior knowledge, try to use the skills they have learnt to solve real world problems. Using this...

Please help with the following matrices questions: *Appreciate it if you can show your work If you are unable to view the questions below, here is link https://massey.limfinity.com/207/hillcipher.pdf...

Confirming Pages C H A P T E R 19 Analyzing Information and Writing Reports Chapter Outline Using Your Time Efficiently Analyzing Data and Information for Reports Identifying the Source of the Data...

Hi I need help with this project that I am doing. It has to be in C language and I don't what to do. This is for my Data Structure course. Please it has to be in Language of C. Programming Assignment...

Chapter 10 Business Process and Information Systems Development \"Jeff, we clean the clubhouse restrooms twice a day . . . in the morning before 7 and again just before lunch. We've been doing that...

I need assistance with the case requirement questions, Part A and Part B (Exhibit 3) and Background, scope, findings and conclusions (exhibit 4) Assessing Information Technology General Control Risk:...

Programming Assignment #2: Smart Arrays COP 3502, Fall 2017 Due: Sunday, September 24, before 11:59 PM Table of Contents...

Case Study: Quick Fix Dental Practice Technology requirements Application must be built using Visual Studio 2019 or Visual Studio 2017, professional or enterprise. The community edition is not...

A creative engineer suggests structuring the TLB so that not all the bits of the presented address need match to result in a hit. Suggest how this might be achieved, and what might be the costs and...

Compute net income for May based on the following transactions: May 1 May 14 May 15 May 17 May 20 May 22 May 31 paid $2,200 for May's rent paid $1,200 for two weeks wages performed $5,200 in...

A bond has the following terms: Principal ....... amount $1,000 Annual interest payment ...$140 starting after five years have passed (i.e., in year 6) Maturity ....... 12 years Callable at $1,140...

If large underabsorbed (underapplied) factory overhead variances occur month after month, the factory overhead rate should be revised to make unit costs more accurate. Comment.

can you please determine what kind of the conflict is in the following mini case. Is it a horizontal or ventricular and why? Mini case: Drug stores and Supermarkets Pharmaceutical (drug/medicine)...

What combination of Key Fields in a Salary Structure Table allows for storage of historical Pay Grade Data for multiple Occupation Group Pay Grade Structures?

Explain the function and purpose of the Job Level Table.

What are Compa-Ratios? Explain the difference between Internal and External (Market Based) Compa-Ratios.