• You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below:
• 3’CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5’
• Additional tools are provided below. 
• a) Provide the complementary strand for the parent strand (above) that would be synthesized during replication of the linear DNA fragment                      
• b) List the enzymes involved in this DNA replication                           
• c)Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is generated and regulated. Indicate the direction of synthesis.
• d)Synthesize a polypeptide from the mRNA.                                        

TOOLS:

• Primer: GUGAUU
• Codon table

 

Transcribed Image Text:

Second letter A G U UUU Phenyl- UUC UAU UAC UGU UCU UCC UCA UCG Tyrosine UGC Cysteine alanine Serine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan A UUA UUG Leucine CAU CAC CCU ССС ССА CCG CGU CGC CUU CUC CUA CUG Histidine C Leucine Proline Arginine CAA CAG CGA CGG A Glutamine AUU AUC Isoleucine A AUA ACU ACC АCА Methionine; ACG AAU AAC AGU AGC Asparagine Serine Threonine AAA AGA A AUG start codon AAG Lysine AGG Arginine G GCU GCC GAU Aspartic GAC acid GGU GGC GUU C GUC G GUA Valine Alanine Glycine GCA GCG GAA GAG GGA GGG A Glutamic acid GUG G First letter Third letter Second letter A G U UUU Phenyl- UUC UAU UAC UGU UCU UCC UCA UCG Tyrosine UGC Cysteine alanine Serine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan A UUA UUG Leucine CAU CAC CCU ССС ССА CCG CGU CGC CUU CUC CUA CUG Histidine C Leucine Proline Arginine CAA CAG CGA CGG A Glutamine AUU AUC Isoleucine A AUA ACU ACC АCА Methionine; ACG AAU AAC AGU AGC Asparagine Serine Threonine AAA AGA A AUG start codon AAG Lysine AGG Arginine G GCU GCC GAU Aspartic GAC acid GGU GGC GUU C GUC G GUA Valine Alanine Glycine GCA GCG GAA GAG GGA GGG A Glutamic acid GUG G First letter Third letter

Answer rating: 100% (QA)

Answer It is given tha... View the full answer