Question: Take a look at the multiple sequence alignment in Figure 23.10 of the globin polypeptides from amino acids 101 to 148. A. Which of these

Take a look at the multiple sequence alignment in Figure 23.10 of the globin polypeptides from amino acids 101 to 148.
A. Which of these amino acids are likely to be most important for globin structure and function? Explain why.
B. Which are likely to be least important?

Step by Step Solution

★★★★★

3.30 Rating (171 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

A The amino acids that are most conserved ie the same in all of the fa... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

894-M-S-B-G (972).docx

120 KBs Word File

Students Have Also Explored These Related Biology Questions!

A multiple sequence alignment of five homologous proteins is shown here: Discuss some of the interesting features that this alignment reveals. 50 3 MLPPLKAPAD APL.MTDKYB IDARYRYWRR HILLTIWLGY...

See solved problem SI before answering this question. Based on the sequence alignment in Figure 23.10, what is/are the most probable time(s) that mutations occurred in the human globin gene family to...

Take a look at the -globin and -globin sequences in Figure 28.11. Which sequences are more similar, the globin in humans and the globin in horses, or the globin in humans and the (3 globin in...

Research Report Students name Professors name Institution Date Contents Title .. 3 Abstract 3 Acknowledgement .3 Introduction .4 Main body of Report/Methodology 5 Various kinds of isolation.6...

is fructose 1,6 biphosphate an allosteric activator or inhibitor? describe the data from the article provided that leads to your conclusion? An Activating Interaction between the Unphosphorylated...

what impact does deleting residues 2-18 have on liver pyruvate kinase? (article provided for assistance) An Activating Interaction between the Unphosphorylated N-Terminus of Human Liver Pyruvate...

Propose an experiment that could "rescue" the truncated (delta 2-18) liver pyruvate kinase? *article provided for help** An Activating Interaction between the Unphosphorylated N-Terminus of Human...

Convert LongWord.java to the equivalent C program named longword.c. While you are converting it into C, make following changes: file read and write: read lines from standard input and print the...

What will be the exit strategy for Nantucket Nectars. Explain the financial and growth analysis of the company. 898-171 Nantucket Nectars It was certainly exciting to have some companies interested...

What will be the exit strategy for Nantucket Nectars. Explain the financial and growth analysis of the company. ( Please use exhibits to do calculations in excel ) 898-171 Nantucket Nectars It was...

In Problem, find dy for each function. y = 200x - x2/30

1. What do historians do with their evidence, meaning how do they utilize historical thinking skills? What questions do they ask of the material? What are they looking for? 2. How is history an...

In how many presentations was " OK " tagged more than 5 0 0 0 times? 0 5 6 7

Opportunity cost is the a. purchase price of a good or service. b. value of leisure time plus out-of-pocket costs. c. best option given up as a result of choosing an alternative. d. undesirable...

Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?

Discuss the major differences among allopatric, parapatric, and sympatric speciation.

The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...

Suppose a bond pays $1,000 each year for five years, starting a year from today, and then repays its principal of $40,000 five years from today. What is the value of the bond if interest rates are 2%...

The following financial data include information regarding Visa Inc. in 2022 (Source: Yahoo! Finance).\ Visa Financial Data\ Use the data to answer questions about Visa and relative valuation to...

Sprint Shoes Inc had a beginning inventory of 9,800 units on January 1, 2013. The costs associated with the inventory were Material Labor Overhead 4.10 per unit S 11 00 per unit 6 00 per unit During...