Question: What does site-directed mutagenesis allow you to do that normal mutagenesis does not?

What does site-directed mutagenesis allow you to do that normal mutagenesis does not?

Step by Step Solution

★★★★★

3.41 Rating (167 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

Sitedirected mutagenesis allows one to make a mutation at a specific place in the gene or re... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Document Format (1 attachment)

Word file Icon

477-M-S-B-M-B (685).docx

120 KBs Word File

Students Have Also Explored These Related Biology Questions!

Q:

What does the fair-use doctrine allow you to do with copyrighted work?

Q:

You are performing site-directed mutagenesis to test predictions about which residues are essential for a protein's function. Which of each pair of amino acid substitutions listed below would you...

Q:

What are three countries that do not allow domestic publicly traded companies to use IFRS to prepare consolidated financial statements?

Q:

Site-directed mutagenesis is used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid...

Q:

Site-directed mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino...

Q:

In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish to change a putative active site histidine residue to a proline by site-directed mutagenesis. The...

Q:

A portion of the coding sequence of a cloned gene is shown here: 5GCCCCCGATCTACATCATTACGGCGAT3 3CGGGGGCTAGATGTAGTAATGCCGCTA5 This portion of the gene encodes a polypeptide with the amino acid...

Q:

The velocity potential = xy does not correspond to an incompressible flow. Prove this by finding two different stream functions depending on whether you use the x- or y-directed velocity to convert...

Q:

of 1000 Hepl Protein Seguences. together, and then placed in a 80C freezer for 20min to cellulose, which is eesential because Hept binds sugarfreene the solation, followed by lyophilization to...

Q:

I need tutors assistance A dollar respect offered out to a resource subject to authentic expense and non financial costs I need assistance with the going with demands please. Stress is known to...

Q:

Johnstone & Johnstone (J&J) has developed a new type of hand lotion with a distinctive fragrance. Before distributing it nationally, J&J will test market the new product. The joint probability of a...

Q:

Brummitt Corporation, is evaluating a new 4-year project. The equipment necessary for the project will cost $3,000,000 and can be sold for $321,000 at the end of the project. The asset is in the...

Q:

3 Cabels warehouse, which has an adjusted basis of $380,000 and a fair market value of $490,000, is condemned by an agency of the Federal government to make way for a highway interchange. The initial...

Q:

Assume you were a regular customer at Chez Pauls, and that the snapper was your favorite item. How would you likely respond to the new menu price? If you bought it, would you consider the item to...

Q:

Why is lipopolysaccharide medically significant?

Q:

How is the structure of a eukaryotic flagellum different from its prokaryotic counterpart?

Q:

How does a DIC microscope increase contrast?

Q:

As part of research on the length of the growing season in mountain, meteorological stations are installed at di erent altitudes. The temperature average rature (in degrees celcius) as well as the...

Q:

QUESTION. 5.PART.1 Monthly Mortgage Payments The average monthly mortgage payment including principal and interest is $982 in the United States. If the standard deviation is approximately $180 and...

Q:

Problem 15-09 Capital Structure Analysis Pettit Printing Company has a total market value of $100 million, consisting of 1 million shares selling for $50 per share and $50 million of 10% perpetual...