Question: A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain

A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences.
cDNA:
5'-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCC TAATTTGTGTGTGGGTATA-CAGTATAATCATATA-3'
Genomic DNA (contains one intron):
5'-ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTA CACCCAACTCGGCCCACCCCCCAGGTTTACACAGTCATACCATACATACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAGATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAATCATATA-3'
Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 12.21? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.

Step by Step Solution

★★★★★

3.38 Rating (157 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

cDNA 5ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGC GGCCAGACTATCACCCAACTCGINTRON... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

894-M-S-B-G (592).docx

120 KBs Word File

Students Have Also Explored These Related Biology Questions!

Chapter 20 describes a technique known as Northern blotting that can be used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of...

The base compositions of samples of genomic DNA from several different animals are given below. Which samples are likely to come from the same species? (a) 27.3% T (b) 29.5% G (c) 13.1% C (d) 36.9% A...

The DNA profiles shown in this problem were prepared using genomic DNA from blood cells obtained from a woman, her daughter, and three men who all claim to be the girls father. Based on the DNA...

Q 2 . A research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5 ' -...

QUESTION 6 Which one of the following is correct about cDNA and genomic DNA? CDNA is produced artificially from mRNA by reverse transcriptase. Expression of proteins using cDNA in bacteria is not...

Commentary Beyond Black Box Epidemiology Douglas L. Weed, MD, PhD "Black box epidemiology" is the most recent addition to a long list of disciplinary subgroups although few practitioners would likely...

Which of the following statements are correct? Explain your answers. A. Restriction enzymes cut DNA at specific sites that are always located between genes. B. DNA migrates toward the positive...

Prompt: Given the genomic sequences for an organism; one of the first steps in identifying the genes is to identify the open reading frames (ORFs). An open reading frame is a maximal length sequence...

Given the genomic sequences for an organism, one of the first steps in identifying the genes is to identify the open reading frames (ORFs). An open reading frame is a maximal length sequence of the...

Kelly Pitney began her consulting business, Kelly Consulting, on April 1, 2019. The accounting cycle for Kelly Consulting for April, including financial statements, was illustrated in this chapter....

Module Assessment, Semester 1, 2021-22 Using a business of your choice- and preferably one in which you are currently working or have previously worked - you will: briefly describe it in terms of its...

Complete the missing value Data table (Click on the following icon in order to copy its contents into a spreadsheet.) Number of Payments or Years 6 17 25 300 Annual Interest Rate 7% 12% 4% 1% Future...

Apply the brute force attack on the captured cipher "GSQTYXIV" to obtain the used key and the plaintext. Note: Caesar cipher is used for encryption a . Key = 4 and Plaintext is Computer b . Key = 5...

Assume the demand for money curve is fi xed and the Fed increases the money supply. The result is that the price of bonds a. rises. b. remains unchanged. c. falls. d. does none of the above.

At the molecular level, explain why quantitative traits often exhibit a continuum of phenotypes within a population. How does the environment help produce this continuum?

In a fairly large population of people living in a commune in the southern United States, everyone cares about good nutrition. All of the members of this population eat very nutritious foods, and...

When artificial selection is practiced over many generations, it is common for the trait to reach a plateau in which further selection has little effect on the outcome of the trait. This phenomenon...

Rachel is 40 years old. She plans on retiring in 25 years when she will be 65 years old. Rachel believes she will live until she is 95. In order to live comfortably, she needs a substantial...

Homework - Chapter 13 Seved Help Save & Exit Submit Check my work 3 You have been given the following return information for a mutual fund, the market index, and the risk free rate. You also know...

Quad Enterprises is considering a new three-year expansion project that requires an initial fixed asset investment of $3 million. The fixed asset will be depreciated straight-line to zero over its...