Q$2.$ A research group has sequenced the cDNA and genomic DNA for a particular gene.

The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences.

cDNA:

$5\text{'}-$

ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAAC

TCGGTTACCTACTAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGTGGGTATACAGTATAAT $-3\text{'}$

Genomic DNA $($contains one intron$)$:

$5^{\text{'}}-$

ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAATGCCAGCGGCCAGACTATCACCCAACTCGGCCCAC

A$.$ Suggest a format for numbering the given sequences and re$-$write both sequences in the boxes below. $(2$ marks$)$

b$.$ Indicate where the intron is located. $(2$ Marks$)$

c$.$ Does the intron contain the normal consensus sequences for splicing. Underline the splice site sequences and indicate whether they agree with the consensus sequences.

$(2$ Marks$)$