A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe
Question:
A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe weighs 538 lb.
(a) If the effort applied is 140 lb, what length of ramp is needed?
(b) What is the MA of the inclined plane?
(c) Another safe weighing 257 lb is loaded onto the same truck. If the ramp is 21.1 ft long, what effort is needed?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 78% (14 reviews)
a Length F R heightF E 538 lb 550 ...View the full answer
Answered By
Charles mwangi
I am a postgraduate in chemistry (Industrial chemistry with management),with writing experience for more than 3 years.I have specialized in content development,questions,term papers and assignments.Majoring in chemistry,information science,management,human resource management,accounting,business law,marketing,psychology,excl expert ,education and engineering.I have tutored in other different platforms where my DNA includes three key aspects i.e,quality papers,timely and free from any academic malpractices.I frequently engage clients in each and every step to ensure quality service delivery.This is to ensure sustainability of the tutoring aspects as well as the credibility of the platform.
4.30+
2+ Reviews
10+ Question Solved
Related Book For
Applied Physics
ISBN: 978-0132109277
10th Edition
Authors: Dale ewen, Neill schurter, P. erik gundersen
Question Posted:
Students also viewed these Mechanics questions
-
A kite 100 ft above the ground moves horizontally at a speed of 8 ft/s. At what rate is the angle between the string and the horizontal decreasing when 200 ft of string have been let out?
-
A batter hits a baseball 3 ft above the ground toward the center field fence, which is 10 ft high and 400 ft from home plate. The ball leaves the bat with speed 115 ft/s at an angle 508 above the...
-
A hot-air balloon is 150 ft above the ground when a motorcycle (traveling in a straight line on a horizontal road) passes directly beneath it going 40 mi/hr (58.67 ft/s). If the balloon rises...
-
Using the information for Sarot, Inc., in SE 4 and SE 5, compute the current ratio, quick ratio, receivable turnover, days sales uncollected, inventory turnover, days inventory on hand, payables...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
In everyday language, risk means the probability of something bad happening. Risk in finance, however, is defined as the standard deviation of the probability distribution of returns. a. Why do these...
-
Green Consultants Pty Ltd specialise in consulting on landscape design. The company developed a predetermined charge-out rate based on hours for each of its consultants on 1 July 2025 to assign the...
-
What qualifications should the systems analysis team be looking for when hiring their new ecommerce development team member? Is it more important to know specific languages or to have an aptitude for...
-
Explain the basics of activity-based costing. Explain the benefits and limitations of activity-based costing.(7-8) Explain cost flows in an activity-based costing system. Differentiate between...
-
You and Terry are unit managers in the shipping division of a pharmaceutical manufacturer. For the past year you have had serious arguments over the use of certain shrink-wrap, pre-packaging...
-
An inclined plane is 10.0 m long and 2.50 m high. (a) Find its mechanical advantage. (b) A resistance of 727 N is pushed up the plane. What effort is needed? (c) An effort of 200 N is applied to push...
-
1. A 3.00-m-long plank is used to raise a cooling unit 1.00 m. What is the MA of the ramp made by the plank? 2. A 2.75-m-long board is used to slide a compressor a vertical distance of 0.750 m. What...
-
Determine the capacity of the production system shown in the following figure. To increase the output of the system, which work center capacity should be increased, and by how much? WC-7 17 units/hr...
-
Why pay plans must adhere to legal requirements, union issues, rewards alignment and equity? What if not ?
-
Mary is a self-employed sales consultant who spends significant time entertaining her clients. She has the following expenses in the current year. Meals Golf Green fees (all business $4,000 500...
-
Common stock value-Constant growth Personal Finance Problem Telephone has paid the dividends shown in the following table. expected to be $5.06. Over the past 6 years, Elk County The firm's dividend...
-
A language L1 is defined by symbols ={0,1}, written as follows: L1 (w w contains '00' as a substring and the length of w is even number} Design a DFA that accepting the language L1. Write the formal...
-
After determining a shortfall in results of the marketing program, what will a company do in response? Question 6Answer a. Try the plan over to determine if the shortfall is accurate. b. Respond by...
-
Title VII may provide a remedy for discrimination on the basis of: a. Religious speech b. Observance of religious holidays c. Both a and b d. None of the above
-
What are current assets and current liabilities? How are they different from non-current assets and non-current liabilities?
-
What risks do alliances pose to partner firms?
-
A man wearing ice skates throws and 8-kg block with an initial velocity of 2 m/s, measured relative to himself, in the direction shown. If he is originally at rest and completes the throw in 1.5 s...
-
The barge weighs 45 000 lb and supports two automobiles A and B which weigh 4000 lb and 3000 lb, respectively, if the automobiles start from rest and drive towards each other, accelerating at BA = 4...
-
The barge B weighs 30 000 lb and supports and automobile weighing 3000 lb. if the barge is not tied to the pier P and someone drives the automobile to the other side of the barge for unloading...
-
Should an MNC purchase Nestl stock yes or no? Recommendations should include the company's sustainability plans, the image of the company, Gordon Growth result, and financial performance. Any...
-
Can the sponsor, or general partner, continue to achieve such high returns? Framed another way, can the general partner earn a 25+% return on the $6,305,000 received at the end of the 10th year? If...
-
Select a hospital that publicly displays their financial performance on their website. Describe the Profit Loss Statement: Review top revenue items Review cost comparison compared to previous year...
Study smarter with the SolutionInn App