Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
Question:
GGAUCCCGCUUUGGGCUGAAAUAG
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 90% (11 reviews)
Mark off the message into triplets b...View the full answer
Answered By
Ayush Mishra
I am a certified online tutor, with more than 3 years of experience in online tutoring. My tutoring subjects include: Physics, Mathematics and Mechanical engineering. I have also been awarded as best tutor for year 2019 in my previous organisation. Being a Mechanical Engineer, I love to tell the application of the concepts of science and mathematics in the real world. This help students to develop interest and makes learning fun and easy. This in turn, automatically improves their grades in the subject. I teach students to get prepared for college entry level exam. I also use to teach undergraduate students and guide them through their career aim.
5.00+
2+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Complete hydrolysis of a heptapeptide showed that it has the following constituent amino acids: 2A, E, L, K, F, V Deduce the amino acid sequence of this heptapeptide from the following data. 1....
-
Give the amino acid sequence of the following polypeptides using only the data given by partial acidic hydrolysis: (a) (b) S, O, P, T H2o STTO PS A, R, C, V, LAC + CR+RV +LA H20
-
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proavin, a dye with a planar...
-
Sparkle is one firm of many in the market for toothpaste, which is in long-run equilibrium. a. Draw a diagram showing Sparkles demand curve, marginal-revenue curve, average total- cost curve, and...
-
1. Should this venture be regarded as entrepreneurial? Is the owner a true entrepreneur? 2. Do you agree with the philosophy expressed here? Is the owner really doing what is best for his family? 3....
-
Let C(x) represent the cost of producing x items and p(x) be the sale price per item if x items are sold. The profit P(x) of selling x items is P(x) = x p(x) - C(x) (revenue minus costs). The average...
-
What is cognitive dissonance?
-
The return on the Tarheel Corporation stock is expected to be 14 percent with a standard deviation of 8 percent. The beta of Tarheel is 0.8. The risk-free rate is 7 percent, and the expected return...
-
If The section below is subjected to bending moment of 30kN.m (causing compression on the top fiber) and shear force of 20kN acting downward, find the depth of the neutral axis x-x (d)? the moment of...
-
A manufacturing company has identified several costs. Indicate whether each of the following costs is an Inventoriable cost(1) or a Period cost(P): 1. Rent Expense on factory equipment Choose. 2....
-
Would RNA of a certain percentage composition of guanine and cytosine denature more or less readily than RNA with a lower percent of guanine and cytosine? Why?
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
Which is the most accurate statement about the recent wave of corporate corruption? a) It has hurt employees, stockholders, and, in general, the entire economy. b) It has actually been very healthy...
-
A TV manufacturer plans to increase his output by 5% each month. If he is now producing 200 TVs per month, calculate, using series a) His monthly output in 12 months from now. b) His total output in...
-
The balance sheet valuation is a: a.Futuristic approach b.None of these c.Historical approach d.Nominal approach Don't use chatgpt please provide valuable answer otherwise be ready for unhelpful...
-
KNOWLEDGE CHECK egendary investor Warren Buffett said, "Gold gets dug out of he ground... Then we melt it down, dig another hole, bury it gain and pay people to stand around guarding it. It has no...
-
Is data and information the same thing? Is data always good (aka clean)? What can occur if data is not ready to be visualized? Please provide details and/or an example for each one stated above.
-
The primary purpose of internal and external audits on real estate trust accounts is to: Question 6Answer a. Ensure the funds are invested with high returns. b. Check the efficiency of the real...
-
Consider the following information about a risky portfolio that you manage and a risk-free asset: E(r p ) = 11 %, p = 15%, r f = 5%. a. Your client wants to invest a proportion of her total...
-
A consumer magazine is evaluating five brands of trash compactors for their effectiveness in reducing the volume of typical household products that are discarded. In the experiment, each block...
-
Repeat problem 11.54 for the network shown in fig 11.62. R2
-
In all OTA problem, the specifications are gm - Iabc sensitivity = 20, maximum gm = 1mS with range of 4 decades. For the circuit in figure 11.50, find gm and Iabc values required for a simulated...
-
In all OTA problem, the specifications are gm - Iabc sensitivity = 20, maximum gm = 1mS with range of 4 decades. For the circuit in figure 11.53, find gm and Iabc values required for a simulated...
-
Practicing a RESUME about an application for cooperative internship. SECTION 1: SUMMARY OF QUALIFICATIONS WHAT'S THE PURPOSE? This section should 'hook' your audience and summarize your best...
-
Use the following data points to form the density-based clusters where eps-10 and MinPts=3. Clearly mention your steps and tell the noise points as well. A1 (0,10), A2 (0,20), A3 (0,27), A4 (10, 15),...
-
Complete both questions 1, & 2 and upload a pdf to the assignment My Seneca portal by February 2nd, 2024 before 11:59PM. Input your answers in the spaces provided and include a calculation page for...
Study smarter with the SolutionInn App