Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
Question:
AUUGGCGCGAGAUCGAAUGAGCCCAGU
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 71% (7 reviews)
Mark the message off into ...View the full answer
Answered By
Joseph Ogoma
I have been working as a tutor for the last five years. I always help students to learn and understand concepts that appears challenging to them. I am always available 24/7 and I am a flexible person with the ability to handle a wide range of subjects.
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Give the amino acid sequence of the following polypeptides using only the data given by partial acidic hydrolysis: (a) (b) S, O, P, T H2o STTO PS A, R, C, V, LAC + CR+RV +LA H20
-
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proavin, a dye with a planar...
-
A previously unknown amino acid, y-carboxyglutamic acid (Gla), was discovered to be a posttranslational modification in the amino acid sequence of the blood clotting protein prothrombin. This amino...
-
What are the values of the engineering economy symbols P, F, A, i, and n in the following functions? Use a question mark for the symbol that is to be determined. (a) NPER (8%, 1500,8000,2000) (b) FV...
-
Explain the following statement: "One can climb the ladder to success only to discover it is leaning against the wrong wall."
-
use the results in the table to (a) draw a normal probability plot, (b) determine the linear correlation between the observed values and expected z-scores, (c) determine the critical value in Table...
-
If the average output of the PV system in Problem 6.7 is \(200 \mathrm{~W}\), the load is changed to run during the day, how much PV output energy is needed for the same load conditions? Assume that...
-
Presented below is a list of costs and expenses usually incurred by Barnum Corporation, a manufacturer of furniture, in its factory? 1. Salaries for assembly line inspectors. 2. Insurance on factory...
-
In 2017, Eraser Corp had Revenue of $229 million, Cost of Goods Sold of $117 million (this includes Depreciation of $46 million), Sales General and Admin Expenses of $33 million, and faced a tax rate...
-
Determine taxable income in each of the following independent cases. In all cases, the company was very profitable in all years prior to 2017 and it had retained earnings of $1,000,000 at the end of...
-
Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
-
List the codons to which the following anticodons would form base pairs: Anticodon: GAC UGA GGG ACC Codon:
-
Explain very briefly the function of following mountings: (i) Steam stop valve (ii) Feed check valve (iii) Blow-off cock (iv) water level indicator (v) Pressure gauge (vi) Safety valve
-
a) Define the terms "heteroskedasticity" and homoskedasticity". Explain the effects of heteroskedasticity on the estimates of the parameters and the variances in a normal regression model (5 marks)...
-
a) What do you understand by the term autocorrelation? What are the consequences of autocorrelation in estimation? (5 marks) b) What are the assumptions underlying the Durbin Watson statistics in...
-
a) Outline the Rostow Stages Theory of Economic Development. (10 Marks) b) Discuss the criticisms of linear models of Economic Development (5Marks)
-
Assume the exchange rate is .96 Swiss francs per U.S. dollar. How many U.S. dollars are needed to purchase 1,500 Swiss francs?
-
1. Explain the following: a) Crude birth rate b) Stable population c) Fecundity (2 marks) (2 marks) (2 marks) 2. Fertility is the production of live birth which starts when a woman gives the first...
-
Find the relative rate of change f(t)f(t) at the given value of t. Assume t is in years and give your answer as a percent. f(t) = 2e 0.3t ; t = 7
-
Chao, Louis, and Mari, unrelated individuals, own all of the shares of Cerise Corporation. All three shareholders have been active in the management of Cerise since its inception. In the current...
-
Use the summing circuit in figure 11.51 to design a circuit that realizes the following function. Vo = 7V1 + 3V2
-
Prove that the circuit in figure p11.66 is a simulated inductor. Find the inductance in terms of C, gm1 and gm2. em 1 i(t) em 2
-
In the Tow-Thomas biquad in figure 11.57, C1=20pF, C2 =10 pF, gm = 10S, gm2 = 80S, gm3 =10S. Find the low pass filter transfer function for the Vi1 V02 i/p- o/p pair. Plot...
-
Assume that CAPM holds. You are given the following information about stock X and the market portfolio, M: E(r) Riskless Asset (f) 0.05 (5%) 0.00 Stock X ? 0.40 Market Portfolio 0.10 0.20 (M) You are...
-
On January 1, 2024, Taco King leased retail space from Fogelman Properties. The 10-year finance lease requires quarterly variable lease payments equal to 3% of Taco King's sales revenue, with a...
-
Distinguish converged infrastructure from hyperconverged infrastructure and give examples?
Study smarter with the SolutionInn App