Question: If a codon consists of four nucleotides, how many codons would be possible? Would this be workable as an aminoacid code?

If a codon consists of four nucleotides, how many codons would be possible? Would this be workable as an aminoacid code?

Step by Step Solution

★★★★★

3.52 Rating (159 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

If the codon were four nucleotides there would be 4 x 4 ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Document Format (1 attachment)

Word file Icon

806-C-O-S-P (64).docx

120 KBs Word File

Students Have Also Explored These Related Organic Chemistry Questions!

Q:

If a codon consists of two nucleotides, how many codons would be possible? Would this be a workable code for the purpose of protein synthesis?

Q:

How many different amino acids could theoretically be encoded by nucleic acids containing four different nucleotides if (a) Each nucleotide coded for one amino acid; (b) Consecutive sequences of two...

Q:

Assume that in the year 2025, the first expedition of humans to Mars discovers several Martian life forms thriving in hydrothermal vents that exist below the planets surface. Several teams of...

Q:

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txt and ecoli.txt from below. Save these files in the same folder...

Q:

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txtand ecoli.txtfrom below. Save these files in the same folder...

Q:

This assignment focuses on arrays and file/text processing. Turn in a file named DNA.java. You will also need the two input files dna.txtand ecoli.txtfrom below. Save these files in the same folder...

Q:

[PYTHON] PROGRAM: DNA This assignment focuses on lists and file/text processing. Submit a file named dna.py. For testing your program you will need two input files dna.txt and ecoli.txt from this...

Q:

You have been hired by a genome lab to write a java program that will read in information from a text file and produce specific results to the screen and an output file. Concepts Arrays of objects...

Q:

Java dna1.txt 10 cure for cancer protein ATGCCACTATGGTAG captain sisko leadership protein ATgCCAACATGgATGCCcGATAtGGATTgA Ada Lovelace non protein CCATt-AATgATCa-CAGTt michael phelps protein...

Q:

Hw3.seq TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC Need help with assignment please. 1. The genetic code of any organism consists of three nucleotides, also referred to as codon. Many...

Q:

What pH is needed to produce this value of Q if the concentration and pressure values are Br2] = 3.00 x 10-4M, Br ] 12.65M. [SO,-] = 9.00M, and Pso, = 2.25 x 10-Patm %3D %3D Express your answer...

Q:

Using this supplemental information, analyze the flowchart in the diagram for Problem 14. The personnel department determines the wage rate of all employees. To start the process, personnel sends the...

Q:

An investigation was conducted to determine the source of reduction in yield of a certain chemical product. It was known that the loss in yield occurred in the mother liquor, that is, the material...

Q:

Contest You play two games against the same opponent. The probability you win the first game is 0.7. If you win the first game, the probability you also win the second is 0.5. If you lose the first...

Q:

Determine the new parameters of the network shown in fig 11.52 if Znew = 10000 Zold. L= 0.5H =1/8 F

Q:

Determine the new parameters of the network shown in fig 11.52 if Wnew = 10000 Wold.

Q:

Given the network in fig 11.54 sketch the magnitude characteristic of the transfer function Vot)

Q:

Bank A will loan you money to buy a home at a stated rate of 8%. Assume you make monthly payments. The APR (Annual Percentage Rate) for this loan is ____; the EAR (Effective Annual Rate) for this...

Q:

Windy Burgers is trying to determine when to harvest a herd of cows that it currently owns. If it harvests the herd in year 1, the NPV of the project would increase over an immediate harvest by 25...

Q:

one or two sentences explaining each line from "previous close" to "1yr target est" 239.989.04(3.63%) As of 1:02PM EDT. Market open. Please explain each line in the data provided for the FedEx...