Question: If an object is thrown upward at 64 feet per second from a height of 20 feet, its height S after t seconds is given

If an object is thrown upward at 64 feet per second from a height of 20 feet, its height S after t seconds is given by
S(x) = 20 + 64t - 16t2
What is the average velocity in the
(a) First 2 seconds after it is thrown?
(b) Next 2 seconds?

Step by Step Solution

★★★★★

3.47 Rating (160 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

a b S2 ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

1386-M-C-L-A-D(3821).docx

120 KBs Word File

Students Have Also Explored These Related Calculus Questions!

What is the DSM-5-TR Diagnosis for Clinical Case below? Clinical Case: Frazier Archer was a 34-year-old single white man who called a mood and personality disorders research program because an...

On the surface of the moon, the acceleration of gravity is -5.28 feet per second per second. If an object is thrown upward from an initial height of 1000 feet with a velocity of 56 feet per second,...

What is the maximum height that the object of Problem 23 reaches? On the surface of the moon, the acceleration of gravity is -5.28 feet per second per second. If an object is thrown upward from an...

An object is thrown upward from a height of 6 feet at a velocity of 64 feet per second. t1 = 0, t2 = 3? (a) Use the position equation s 16t2 + v0t + s0 to write a function that represents the...

Tutorial Exercise If an object is thrown upward at 128 feet per second from a height of 48 feet, its height S after t seconds is given by the following equation. S(t) = 48 + 128t - 16t (a) What is...

please solve for 1 to 3 1. [-/2.5 Points] DETAILS HARMATHAP12 9.3.003. MY NOTES ASK YOUR TEACHER PRACTICE ANOTHER For the function A(x) given in the table, find the average rate of change over each...

If a ball is thrown upward at 64 feet per second from a height of 4 feet, the height of the ball can be modeled by S = 4+64t-16t2 feet, where t is the number of seconds after the ball is thrown. How...

PLEASE SOLVE If an object is thrown upward at 128 feet per second from a height of 32 feet, its height S after + seconds is given by the following equation. 5() = 52 + 128: - 16:2 (3) What is the...

8. A ball is thrown upward at 64 feet per second from a height of 80 feet. In the absence of air resistance it will have height h(r) = 45:2 +64I+80feeL (a) (3 pts) After how many seconds will the...

1 (1 point) Solve the problem. Your company uses the quadratic model y = -4.5x2 + 150x to represent the average number of new customers who will be signed on (x) weeks after the release of your new...

1) The number of females in science continues to show steady increases. The number of female researchers in a certain country can be modeled by the function F(x)=0.753x to the power 1.277, where x is...

The Reynolds number is a dimensionless group defined for a fluid flowing in a pipe as Re = Dup/ where D is pipe diameter, u is fluid velocity, p is fluid density, and is fluid viscosity. When the...

What are the advantages of being eukaryotic (as opposed to prokaryotic)?

Which type of automobile insurance pays for loss of or damage to a covered vehicle, such as that caused by fire, flood , hail, impact with an animal, theft, vandalism, or wind?

1. Princess eats 60g of oats for breakfast before her biology exam. Each gram of oats contains three (3) molecules of glucose. 2. Assuming Princes uses 180 molecules of adenosine triphosphate in...

You have been given a DNA fragment obtained from the genome of Bacillus thuringiensis below: 3CACTAACTGTCGCCAGGTCTGATAGACATATAACTGTTGGCGTACATAAGAAGGATCAAAAAA5 Additional tools are provided below. a)...

1 Frances Redi disproved spontaneous generation by designing a controlled experiment where he placed raw meat in six (6) jars. He covered three jars with a fine net and left three jars open. After a...

Par for n2 3. Select all what applies to the sequence (an}, from the following list. (Remember: if a 2 b then max {a, b} = a and min {a,b} = b) 00 35 (A) as = 45 32006 (B) a2006 = 42006 (C)...

You are a consultant hired by an established medium-sized manufacturing corporation with 250 employees. The corporation directly markets one unique product. The corporation is run by a new CEO and 11...

16.1. A general-purpose auto-repair garage has one mechanic who specializes in muffler installations. Customers seeking service arrive at an average rate of 2 per hour, with a Poisson distribution....

(From Sholander24) In a standard clover-leaf interchange, there are four ramps for making right-hand turns, and inside these four ramps, there are four more ramps for making left-hand turns. Your car...

(From vos Savant26) A reader of Marilyn vos Savants column wrote in with the following question: My dad heard this story on the radio. At Duke University, two students had received As in chemistry...

Barbara Smith is interviewing candidates to be her secretary. As she interviews the candidates, she can determine the relative rank of the candidates but not the true rank. Thus, if there are six...

Possible answers for the first question: $52.50; $35.00; $420.00; $210.00; $315.00 Consider the case of Mainway Toys Co.: Mainway Toys Co. currently has 25,000 shares of common stock outstanding. Its...

An asset has an average return of 1 1 . 2 7 percent and a standard deviation of 2 4 . 0 9 percent. What is the most you should expect to earn in any given year with a probability of 2 . 5...

Compute the Weighted Average Cost of Capital ( WACC ) for Bob s Crystal Pool Supply given that the after - tax cost of debt financing rd ( 1 T ) is 1 0 % , the cost of preferred stock financing ( rp...