Question: If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA

If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed?
A. RNA polymerase I
B. RNA polymerase II
C. RNA polymerase III

Step by Step Solution

★★★★★

3.49 Rating (159 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

A Ribosomal RNA 58S 18S and ... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Document Format (1 attachment)

894-M-S-B-G (573).docx

120 KBs Word File

Students Have Also Explored These Related Biology Questions!

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA

Compare and contrast the activity of DNA and RNA polymerases. What is the function of each? What are the substrates of each? What is the main difference in the behavior of the two polymerases?

Two preparations of RNA polymerase from E. coli are used in separate experiments to catalyze RNA synthesis in vitro using a purified fragment of DNA carrying the argH gene as template DNA. One...

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

In eukaryotes, the three RNA polymerases, Pol I, II, and III, each transcribes unique genes required for the synthesis of ribosomes: 25S and 18S rRNAs (Pol 1), 55 rRNA (Pol III), and mRNAs for...

Help me out with these questions :) 1. During transcription, the strand of DNA that base pairs with the new mRNA is called the: A. Non-template strand B. Parental strand C. Coding strand D. Template...

Match one of the following terms with each of the descriptions given below. Terms: (1) sigma (s) factor; (2) poly(A) tail; (3) TATAAT; (4) exons; (5) TATAAAA; (6) RNA polymerase III; (7) intron; (8)...

Determine which are true of prokaryotic and eukaryotic transcription. In prokaryotic cells in eukaryotic cells ( CHOOSE ALL THAT APPLY ) RNA polymerase bids directly to the promoter of the gene;...

please read the question and write a program in Perl language with the out put shows Exercise 2.14 In Eukaryotes (higher organisms whose cells have a nucleose), promoter sequences are more variable...

The subunit of polymerase has a function of ____________ a) Promoter binding b) Catalytic center c) Template binding d) Cation binding 2. Presence of the heparin promotes transcription. a) True b)...

A Carnot heat engine receives heat from a reservoir at 900C at a rate of 800 kJ/min and rejects the waste heat to the ambient air at 27C. The entire work output of the heat engine is used to drive a...

Let X have the standard normal pdf, fx(x) = (l/2)e-x2/2. (a) Find EX2 directly, and then by using the pdf of Y = X2 from Example 2.1.7 and calculating E Y. (b) Find the pdf of Y = |X|, and find its...

Suppose the price of beef rises by 10 percent and the quantity demanded of beef falls by 20 percent. We can conclude that (A) demand for beef is price elastic and consumer spending on beef is...

Suppose the government shown in Exhibit 10 uses contractionary monetary policy to reduce infl ation from 9 to 6 percent. If people have adaptive expectations, then a. the economy will remain stuck at...

In a large herd of 5468 sheep, 76 animals have yellow fat, compared with the rest of the members of the herd, which have white fat. Yellow fat is inherited as a recessive trait. This herd is assumed...

The human MN blood group is determined by two codominant alleles, M and N. The following data were obtained from various human populations: A. Calculate the allele frequencies in these five...

You will need to understand solved problem S4 before answering this question. In an island population, the following data were obtained for the numbers of people with each of the four blood types:...

Excel Online Structured Activity: CAPM, portfolio risk, and return Consider the following information for three stocks, Stocks A , B , and C . The returns on the three stocks are positively...

Suppose you receive $110 at the end of each year for the next three years. a. If the interest rate is 8%, what is the present value of these cash flows? b. What is the future value in three years of...

Optimal Portfolios (You may want to draw a graph for this example, be sure to clearly label the axis and curves) Discuss the shape of the Investment Opportunity Set of any two risky assets with a...