List the codons to which the following anticodons would form base pairs: Anticodon: GAC UGA GGG ACC
Question:
Anticodon: GAC UGA GGG ACC
Codon:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 54% (11 reviews)
The codons have bases that a...View the full answer
Answered By
Rohith Bellamkonda
I am studying in IIT Indore,the most prestigious institute of India.I love solving maths and enjoy coding
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
List the anticodons to which the following codons would form base pairs: Codon: UUG CAC ACU GAA
-
According to wobble rules, what codons should be recognized by the following anti-codons? What amino acid residues do these correspond to? (a) 5 - ICC - 3 (b) 5 - GCU -3
-
Which of the following amino acids are likely to be linked to only one species of tRNA? What are their anticodons? (a) Phe (b) Leu (c) His
-
Chris Co. purchased a piece of equipment and incurred the following costs. Which of these costs is properly capitalized and recorded as part of the cost of the equipment? I. Freight charges to...
-
What is meant by the term entrepreneur?
-
Abby Tudor recently turned 40. Her knees ache and she feels shortness of breath during exercise, along with periodic dizziness and general fatigue. Despite trying various diet and exercise regimes,...
-
A PV battery system has an end-to-end efficiency of \(77 \%\). The system is used to run an all-AC load that is run only at night. The charge controller efficiency is \(96 \%\) and the inverter...
-
Intercompany Receivables and Payables 1_08 Polychromasia, Inc. had a number of receivables from subsidiaries at the balance sheet date, as well as several payables to subsidiaries. Of its five...
-
Solve. log4(5x-2)=3 The solution is x=
-
Indicate the effects of the following business transactions on the accounting equation of a proprietorship. Transaction a is answered as a guide. a. Received $50,000 cash from the owner. Answer:...
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
Explain how the doping of polyacetylene increases its electrical conductivity.
-
An uninsured motorist coverage claim is generally treated as a a. first-party claim. b. third-party claim. c. second-party claim. d. none of the above.
-
a) Use the data in the table below to answer the questions that follow: Population Country A 1,000 Births Deaths Immigrants Emigrants 15 Country B 10 80 3 0 20 20 Crude Birth Rate Crude Death Rate...
-
a) State the core values of Economic Development. (5 Marks) b) Comment on the usefulness of Gross Domestic Product (GDP) as a measure of economic well-being of a country. (10 Marks)
-
a) Explain the process of agricultural transformation in the process of Economic development. (10 Marks) b) Outline the contribution of agriculture in the process of Economic Development (5 Marks)
-
2. a) Discuss the reasons for population explosion in Kenya. b) Explain the measures that can be used to curb population explosion.
-
Use Gaussian elimination to find all solutions. 1. 2. x12x2+3x3 = 11 4x1+x2 x3 = 4 - 2x1 x2+3x3 = 10 3x16x26x3 = 9 2x1 5x24x3 = 6 - -x1+16x214x3 = -3 x1+x2 x3 = 7 - 3. 4x1 x2+5x3 = 4 2x12x2 3x3 = 0...
-
Find the derivative. Assume that a, b, c, and k are constants. f(x) = ax + b cx + k
-
On April 29, 2015, Auk Corporation acquires 100% of the outstanding stock of Amazon Corporation (E & P of $750,000) for $1.2 million. Amazon has assets with a fair market value of $1.4 million (basis...
-
Find the transfer function of the OTA filter in figure 11.68. Express Wo and Q in terms of the capacitances and transconductances. What kind of filter is it. Vo 0 en 2 em 3
-
Find the transfer function of the OTA filter in fig 11.69. Express Wo and Q in terms of the capacitances and transconductances. What kind of filters is it? Virl 2 En 1
-
Refer to the ac/dc converter low-pass filter application of example 11.25. If we put the converter to use powering a calculator, the load current can be modeled by a resistor as shown in fig 11.25....
-
The current spot price of a barrel of oil. So, is $70.63. The per year continuously compounded risk-free rate of interest. r. is 3%, storage cost. u. is 2%, and convenience yield, y, is 8%. The...
-
It was decided during 2021 to change the method of valuation from WACC to FIFO. The change in the accounting policy has been accounted for in the current year The raw material inventories have been...
-
Solve. Write your answer using interval notation. You can type oo (two lowercase o) to represent co. 102-9-17 Preview Box 1: Enter your answer using interval notation. Example: [2,5) Use U for union...
Study smarter with the SolutionInn App