Question: Find vector v from point A to the origin, where AB = 4i - 2j and B is the point ( -2, 5).

Find vector v from point A to the origin, where AB⇀= 4i - 2j and B is the point ( -2, 5).

Step by Step Solution

★★★★★

3.43 Rating (166 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

To find the vector from point A to the origin we ne... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Algebra And Trigonometry Graphs Questions!

Q:

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Q:

A signal travels from point A to point B. At point A, the signal power is 100 W. At point B, the power is 90 W. What is the attenuation in decibels?

Q:

Determine the position vector r directed from point A to point B and the length of cord AB. Take z = 4m. -6 m

Q:

A. Find an equation of the plane that passes through the given point and is perpendicular to the given vector or line. Point Perpendicular to (0, 6, 0) n = 4 i + 4 k B. Find the distance between the...

Q:

a. Change z = 3 - 3i to polar form. b. Change z = -5 cis330 to rectangular form. c. Changez = 2 sqrt(2) (cos45 + i sin 45)to rectangular form d. Find the linear combination of vector v with the...

Q:

4. [-/2 Points] DETAILS LARPCALC11 6.3.018. Find the component form and the magnitude of the vector v. initial point (-4, 6) terminal point (17, -66) component form V = magnitude Iv =11. [-/1 Points]...

Q:

C language ICS 103 12EB 15 lerm Statem The line intersection problem is a very fundamental problem in game programming. For example, in order to decide if a car is going to hit a wall in a game, the...

Q:

PLEASE MAKE SURE ALL ARE CORRECT Use the image to answer the question. Find the components of vector v. (1 point) O v={9,1) O v={-53) O v={6,1} O v= (5,7} -10 Which could be the initial point of...

Q:

Use the image to answer the question. Find the components of vector v. (1 point) O v={9,1) O v={-53) O v={6,1} O v= (5,7} -10 Which could be the initial point of vector u if it has a magnitude of 17...

Q:

v webassign.net C + 88 X Content Content W MAT 122 6.3 HW - MAT 122 Precalculus Mathematics, F.. LIVE Qatar - Senegal. LiveStream, Broadcast / Football. Wor... 1. [-/5 Points] DETAILS LARPCALC11...

Q:

Shonda owns 1,000 of the 1,500 shares outstanding in Rook Corporation (E & P of $1 million). Shonda paid $50 per share for the stock seven years ago. The remaining stock in Rook is owned by unrelated...

Q:

How you believe a company of your choosing is using standard costing ? H ow does a company of your choice use standard costing ?

Q:

Investigate a Notable Financial Fraud other than madoff Analysis: Analyze the case, exploring the following: How it happened: Detail the mechanics of the fraud or scheme. Who was harmed: Identify the...

Q:

The data in the accompanying table represents the percentage of workers who are members of a union for each U.S. state and the District of Columbia (AARP Bulletin, September 2009). a. Construct a...

Q:

Find the mean and standard deviation of the incomes (INCOME) of the heads of households. We know that the distribution of income is extremely positively skewed. Briefly describe what the two...

Q:

Compute the mean and standard deviation of the ages (AGE) of the heads of households. Assuming that the distribution is bell shaped what do the mean and standard deviation tell you?

Q:

The unemployment rate is an important measure of a countrys economic health. The unemployment rate measures the percentage of people who are looking for work and who are without jobs. Unfortunately,...

Q:

Which of the following statements is NOT correct? a. A swap can be viewed as a portfolio of forward contracts with different maturity dates. b. The options clearing corporation reduces credit risk...

Q:

425 Nona purchased a new car earlier today for $32,000. She financed the entire amount using a five-year loan with a 3 percent interest rate (compounded monthly). (a) Compute the monthly payments for...

Q:

You have found the following historical information for the Daniela Company: Year 1 Year 2 Year 3 Year 4 Stock price $49.24 $67.43 $61.19 $67.07 EPS 2.59 2.65 2.82 2.81 Earnings are expected to grow...