Question: Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis?
Identify the polypeptide encoded by the DNA sequence below, in

5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3' CCTGGATACTAGTGGACGAGGGGCTCACGACAAATCCACCC 5

Step by Step Solution

★★★★★

3.47 Rating (173 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

The mRNA includes an AUG start codon and ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Document Format (1 attachment)

Word file Icon

930-M-S-B-C (1798).docx

120 KBs Word File

Students Have Also Explored These Related Biochemistry Questions!

Q:

A human gene called the -globin gene encodes a polypeptide that functions as a subunit of the protein known as hemoglobin. Hemoglobin is found within red blood cells; it carries oxygen. In human...

Q:

Imagine that you are evaluating the early steps in translocation and processing of the secretory protein prolactin. By using an experimental approach similar to that shown in Figure 13-7, you can use...

Q:

The following DNA sequence occurs in a bacterium (the promoter sequence is located to the left but is not shown). 5-CAATCATGGACTGCCATGCTTCATATGAATAGTTGACAT-3...

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

A gene contains 141 codons. How many nucleotides are present in the genes coding sequence? How many amino acids are expected to be present in the polypeptide encoded by this gene?

Q:

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5 'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA 3 ' Question options: 7 8 1 0 1 3 Hide question 3 5 feedback...

Q:

Acridine dyes such as proflavin are known to induce primarily single base-pair additions and deletions. Suppose that the wild-type nucleotide sequence in the mRNA produced from a gene is...

Q:

Which of the following represents the maximum number of amino acids that could be incorporated into a polypeptide encoded by 21 nucleotides of messenger RNA? (A) 3 (B) 7 (C) 21 (D) 42

Q:

The following DNA sequence occurs in the nontemplate strand of a gene in a bacterium (the promoter sequence is located to the left but is not shown): 5-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3 (a)...

Q:

Cell biology textbooks often discuss cellular proteins encoded by genes that are members of a gene family. Examples of such proteins include myosins and glucose transporters. Look through a cell...

Q:

This week your immediate supervisor assigned you as the senior in charge of an audit of an important international client in New York City because of your excellent work, and because she learned how...

Q:

A 1.00-g sample of solid barium sulfate and a similar 1.00-g sample of solid calcium sulfate were added to water at 25C to give 1.00 L of solution. Calculate the concentrations of Ba2+, Ca2+, and...

Q:

( b ) In the following independent situations, identify whether the revenue can be recognized based on MFRS 1 5 Revenue from Contracts with Customer. Support your answer with a brief explanation and...

Q:

A random sample of 36 observations has been drawn. Find the probability that the sample mean is in the interval 47 X 53 for each of the following population distributions and population parameter...

Q:

What structural features do a sphingomyelin and a phosphatidylcholine have in common? How do the structures of these two types of lipids differ?

Q:

Write the structural formula for a triacylglycerol, and name the component parts.

Q:

Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by double-stranded DNA? (b) What...

Q:

you have already solved this question but i just want to now how did you get Yield to maturity = YTM = 3.1% Question Assume that we know the following A bond will make a risk-free payment of 1000 SEK...

Q:

The first number at each node in the tree below is the 0.5-year rate at that node. The second number at each node is the price of $1 par of a 0.5-year zero at that node. The third number (if it...

Q:

Pump Water is a firm that exists in a world of almost perfect capital markets, where the only imperfection is the presence of corporate taxes. There exists federal government bonds in this world that...