Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?
Question:
Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 80% (5 reviews)
Ribosomal proteins having high isoelectric point pI values can be advantageous for ribosome stability due to several reasons Maintenance of Ribosome S...View the full answer
Answered By
Nyron Beeput
I am an active educator and professional tutor with substantial experience in Biology and General Science. The past two years I have been tutoring online intensively with high school and college students. I have been teaching for four years and this experience has helped me to hone skills such as patience, dedication and flexibility. I work at the pace of my students and ensure that they understand.
My method of using real life examples that my students can relate to has helped them grasp concepts more readily. I also help students learn how to apply their knowledge and they appreciate that very much.
4.00+
1+ Reviews
10+ Question Solved
Related Book For
Biochemistry Concepts And Connections
ISBN: 9780134641621
2nd Edition
Authors: Dean Appling, Spencer Anthony-Cahill, Christopher Mathews
Question Posted:
Students also viewed these Sciences questions
-
In eukaryotes, the three RNA polymerases, Pol I, II, and III, each transcribes unique genes required for the synthesis of ribosomes: 25S and 18S rRNAs (Pol 1), 55 rRNA (Pol III), and mRNAs for...
-
Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
-
A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to gel electrophoresis in the presence of sodium dodecyl sulfate (SDS), the protein gives three bands with...
-
What are some ways that the antibody-protein complex can be visualized in ELISA or western blots?
-
Imelda is making equal-sized monthly payments of $288 on her car loan. She has only 18 payments left. Each month, the portion of her payment that goes to pay interest and the portion that goes to...
-
An industrial engineer is conducting an experiment on eye focus time. He is interested in the effect of the distance of the object from the eye on the focus time. Four different distances are of...
-
According to Einstein's theory of relativity, light should bend when it passes through a gravitational field. This was first tested experimentally in 1919 when photographs were taken of stars near...
-
The 2011 and 2012 financial statements of Ken's Sportswear follow: a. Compute all relevant ratios for 2012.b. Prepare common-size financial statements.c. Evaluate the company's financial performance...
-
1-What is the significance of these three matrices regarding their relevance for strategic planning specific for southwest airlines. 2- Describe the key information for each and how information from...
-
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
-
The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and Lys, respectively. Can you think of a reason why polyG was not used as a translation template in...
-
In Exercises 56, use the functions equation, and not its graph, to find a. The minimum or maximum value and where it occurs. b. The functions domain and its range. f(x) = -x 2 + 14x - 106
-
In the context of programming, UML class diagrams provide an overview of your programming goal without wrapping yourself around the metaphorical axle. UML class diagrams list the two essential...
-
Convert the following to vertex form. f(x) = (x+2)(x+4) Make sure to write your answer in function form, i.e., f(x) = ...
-
Context/Scenario In the last few years, employee well-being has become an increasingly critical issue in people management.Organisations which have not paid sufficient attention to this issue risk...
-
Consider the function: f = 68x4 +12x-2x + 9x+3. (a) Using MATLAB, estimate f(x) over the interval 1x3 in increments of 0.02 using a base point of x = 1 and a: first-order Taylor series approximation...
-
3. Non-ionic dextran methacrylate (dex-MA) hydrogel is prepared by photopolymerization through crosslinking of methacrylate bonds (see figure). The hydrogel is prepared with 10% (w/v) of dex-MA (i.e....
-
What information can a user of financial statements obtain from the statement of cash flows?
-
For the data in Exercise 17-19, use the FIFO method to summarize total costs to account for, and assign these costs to units completed and transferred out, and to units in ending work in process....
-
What are micro RNAs?
-
What are small nuclear RNAs?
-
What are some key differences in how mRNA is processed in prokaryotes versus eukaryotes?
-
6) Consider an object with mass m that is thrown with an initial speed Vo at an angle with respect to the ground. The gravitational acceleration is g and it can be assumed to be constant. Derive the...
-
A camera with a CCD chip of 5 x 5 mm and 1000 x 1000 sensing elements, that is equipped with a 20 mm lens, is focused on a square flat area located 0.2 m away. How many line pairs per mm will this...
-
A water park has a giant bucket that dumps water over the top of a playground (see the image below). The bucket is approximately the size of a 55-gallon drum with height 85.0 cm and diameter 57.0 cm....
Study smarter with the SolutionInn App