The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the
Question:
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the Shine–Dalgarno sequence and the initiator codon.
5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (3 reviews)
In the provided mRNA sequence for E coli ribosomal L1...View the full answer
Answered By
ANDREW KIPRUTO
Academic Writing Expert
I have over 7 years of research and application experience. I am trained and licensed to provide expertise in IT information, computer sciences related topics and other units like chemistry, Business, law, biology, biochemistry, and genetics. I'm a network and IT admin with +8 years of experience in all kind of environments.
I can help you in the following areas:
Networking
- Ethernet, Wireless Airmax and 802.11, fiber networks on GPON/GEPON and WDM
- Protocols and IP Services: VLANs, LACP, ACLs, VPNs, OSPF, BGP, RADIUS, PPPoE, DNS, Proxies, SNMP
- Vendors: MikroTik, Ubiquiti, Cisco, Juniper, HP, Dell, DrayTek, SMC, Zyxel, Furukawa Electric, and many more
- Monitoring Systems: PRTG, Zabbix, Whatsup Gold, TheDude, RRDtoo
Always available for new projects! Contact me for any inquiries
4.30+
1+ Reviews
10+ Question Solved
Related Book For
Biochemistry Concepts And Connections
ISBN: 9780134641621
2nd Edition
Authors: Dean Appling, Spencer Anthony-Cahill, Christopher Mathews
Question Posted:
Students also viewed these Sciences questions
-
Find a basis for the space spanned by the given vectors, v 1 ,....,v 5 . 0 0 1 2 5 -3 3 -4 3
-
The circuit (Figure 1) for practical 1 is a single BJT common emitter amplifier. Given the following set of requirements, we would calculate and choose the suitable component values: Supply voltages...
-
Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...
-
Solomon Company's cost and production data for two recent months included the following: March April Production (units) 400 600 $2,400 $ $2,400 $1,200 Rent Utilities 800 Required a. Separately...
-
Assume that you borrow $25,000 on April 1, 2004, at an annual rate of 7%. How much will you owe on March 31, 2005 if you make no payments until that date? How much will you owe on March 31, 2006 if...
-
Knowing that the radius of each pulley is 7.2 in. and neglecting friction, determine the internal forces at point J of the frame shown. - 3 ft- 5.4 it -0,6 ft 1.8 ft 24 t 2.4 ft 0.6 ft
-
What is the difference between an accountor and an accountee? Is it important for the needs of both to be taken into account when designing an accounting system? Provide reasons for your view.
-
A bond with a coupon rate of 7% makes semiannual coupon payments on January 15 and July 15 of each year. The Wall Street Journal reports the asked price for the bond on January 30 at 100:02. What is...
-
Consider the triangle AABC formed by the points A(0, 1, 1), B(1, 1, 4), and C(-2, 5, 1). (a) Compute AB AC by using both methods of finding the cross product: expanding the products with the...
-
Chaperones are generally thought to facilitate protein folding. What additional functions do mitochondrial chaperones perform?
-
Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?
-
Draw Fischer projections of the following molecules: (a) The S enantiomer of 2-bromobutane (b) The R enantiomer of alanine, CH3CH (NH2) COOH (c) The R enantiomer of 2-hydroxypropanoic acid (d) The S...
-
How did the National Energy Act of 1978 encourage energy efficiency and conservation ?
-
Find I, R, and 2 in the following figure. Give the complete answer with reasoning. Provide a solution with all the steps with proper labels, and numbers. 4.00 I 2.00 A R www E= 30.0V +H 3.00 6.00...
-
How has the role of the healthcare manager changed regarding proposing change?
-
6. The neighborhood kids have built a ramp 1.00 m tall with an angle of 30.0% to the horizontal. One of the kids can get up to 7.00 m/s on flat ground before starting up the ramp. Assume rolling...
-
Write a Java program and demonstrate the followings: a) Shallow copy of an object b) Deep copy of an object c) Cloning of an object d) Deep cloning of an object. For each case, you have to write...
-
In Reliability Ques (March 2004), the exponential distribution was used to model the lengths of life of CD-ROM drives in a two-drive system. The two CD-ROM drives operate independently, and at least...
-
For the data in Exercise 17-19, use the FIFO method to summarize total costs to account for, and assign these costs to units completed and transferred out, and to units in ending work in process....
-
Which type of RNA is the biggest? Which is the smallest?
-
Sketch a typical cloverleaf structure for transfer RNA. Point out any similarities between the cloverleaf pattern and the proposed structures of ribosomal RNA.
-
Why do we say that micro RNAs are involved in the oldest evolutionary relationship?
-
A bank wants to install an alarm system with 3 movement sensors. To prevent false alarms produced by a single sensor activation, the alarm will be triggered only when at least two sensors activate...
-
What would be the value of x after the following statements were executed? int x; for (x=0; x
-
The following information relate to the business of Katwishi as at 31-12-16 K'000 Purchases Sales Returns inwards Returns outwards Debtors 64,700 125,600 6,340 1,900 11,250 Creditors 7,900...
Study smarter with the SolutionInn App