What is the difference in the requirement for a primer in RNA transcription compared to DNA replication?
Question:
What is the difference in the requirement for a primer in RNA transcription compared to DNA replication?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 50% (2 reviews)
No primer i...View the full answer
Answered By
Zablon Gicharu
I am an educator who possesses the requisite skills and knowledge due to interacting with students for an extended period. I provide solutions to various problems in step-by-step explanations, a well-thought approach and an understandable breakdown. My goal is to impart more straightforward methodologies and understanding to students for more remarkable achievements.
5.00+
4+ Reviews
10+ Question Solved
Related Book For
Biochemistry
ISBN: 9781305961135
9th Edition
Authors: Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Question Posted:
Students also viewed these Sciences questions
-
What happens in the market for coffee if the price of sugar rises? Select one: a. supply shifts to the left and price b. supply shifts to the right and price decreases c. demand shifts to the left...
-
In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki...
-
In eukaryotes, the three RNA polymerases, Pol I, II, and III, each transcribes unique genes required for the synthesis of ribosomes: 25S and 18S rRNAs (Pol 1), 55 rRNA (Pol III), and mRNAs for...
-
You invested $1000 in Sinoland Bank stock when Sinoland/US Dollar exchange rate was 10:1, and you received exactly 200 local shares of the stock. The stock price rises 23% in local currency terms,...
-
Edgemont Repairs began operations on January 1, 2010. The 2010, 2011, and 2012 financial statements follow: On January 1, 2012, the company expanded operations by taking out a $40,000 long-term loan...
-
Soft Pearl Company incurs the following costs to produce 50000 light switches for floor lamps in 2020. The Ignition Company has offered to supply the switches for $8 per unit. An analysis of the...
-
BlackBerry Ltd. has a target current ratio of 2.0 but has experienced some difficulties financing its expanding sales in the past few months. At present, the firm has current assets of $750,000 and a...
-
Chuck Sox makes wooden boxes in which to ship motorcycles. Chuck and his three employees invest a total of 40 hours per day making the 120 boxes. a) What is their productivity? b) Chuck and his...
-
A student addresses a bully mocking another student, " what you're doing isn't even clever or funny, everyone has a right ti express who they are.. you know like we say every morning.. liberty and...
-
What is a factor? Why is it important in transcription?
-
The malateaspartate shuttle yields about 2.5 moles of ATP for each mole of cytosolic NADH. Why does nature use the glycerolphosphate shuttle, which yields only about 1.5 moles of ATP?
-
Solve the following the equation. 2x(1.1) $000 1.12
-
How much do you need to deposit today at 5.8% interest compounded continuously in order to have $2,280 in 9 years?
-
Let A - 9 -2] -2 6 (a) Determine the eigenvalues and eigenvectors of A. (b) Write the spectral decomposition of A.
-
Suppose labor (L) and capital (K) are perfect substitute inputs. Each additional hour of labor increases output by one unit, and each additional hour of capital increases production by 2 units....
-
How would a human resources department use information in the operating budgets? 2. How would maintenance departments use information in the budget? 3. How would other service departments use...
-
Can you reply to this classmate agreeing with their comment? I think the team worked adequately in the scenario I think they could have worked on communicating better. With that being said I think...
-
The maturity value of a $50,000, 90-day, 10% note payable is: a. $51,250 b. $48,750 c. $1,250 d. $5,000
-
In each of the following independent cases, document the system using whatever technique(s) your instructor specifies. a. Dreambox Creations (www.dreamboxcreations.com/) in Diamond Bar, California,...
-
How many amino acid copolymers can be specified by polynucleotides consisting of two alternating nucleotides? What are the sequences of these polypeptides?
-
Predict the effect on protein structure and function of an AT to GC transition in the first codon position for lysine?
-
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
-
Overview You recently created a direct mail campaign for the Kitchener Soccer Club to attract more signups for their programs. Now they are looking to run a retention campaign via email marketing to...
-
In a post, share an example of how language has changed your experience of the world. Think of specific instances when the words used to describe something (even a situation) changed your...
-
Simmel argued a century ago that the pace of life had quickened inexorably: the populace of the metropolis was constantly searching out new entertainments and distractions, but satisfaction was only...
Study smarter with the SolutionInn App