Question: In Exercises an object dropped from rest from the top of a tall building falls y = 16t 2 feet in the first t seconds.

In Exercises an object dropped from rest from the top of a tall building falls y = 16t2 feet in the first t seconds.

Find the speed of the object at t = 4 seconds and confirm your answer algebraically.

Step by Step Solution

★★★★★

3.31 Rating (142 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

The acceleration of the object is a 16t2 a 1642 a 64 So after 4 seconds the object will have fallen ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Calculus Graphical, Numerical, Algebraic Questions!

Q:

An object dropped off the top of a tall building falls vertically with constant acceleration. If s is the distance of the object above the ground (in feet) t seconds after its release, then s and t...

Q:

A person starts from rest at the top of a large frictionless spherical surface, and slides into the water below (see the drawing). At what angle θ does the person leave the surface? ----

Q:

A skier starts from rest at the top of a frictionless slope of ice in the shape of a hemispherical dome with radius R and slides down the slope. At a certain height h, the normal force becomes zero...

Q:

In Exercises an object dropped from rest from the top of a tall building falls y = 16t 2 feet in the first t seconds. Find the speed of the object at t = 3 seconds and confirm your answer...

Q:

An object dropped from rest from the top of a tall building falls y=16t^2 feet for the first t seconds. Find the speed of the object at t=4 seconds and confirm your answer algebraically

Q:

An object dropped from rest from the top of a tall building falls y=16t^2 feet for the first t seconds. Find the speed of the object at t=4 seconds and confirm your answer algebraically

Q:

In Exercises an object dropped from rest from the top of a tall building falls y = 16t 2 feet in the first t seconds. Find the average speed during the first 4 seconds of fall.

Q:

In Exercises an object dropped from rest from the top of a tall building falls y = 16t 2 feet in the first t seconds. Find the average speed during the first 3 seconds of fall.

Q:

An object dropped from rest from the top of a tall building falls y=16t^2 feet for the first t seconds. Find the average speed during the first 3 second of the fall

Q:

An object dropped from rest from the top of a tall building falls y=16t^2 feet for the first t seconds. Find the average speed during the first 3 second of the fall

Q:

4. Part of the MRNA sequence of an exon of a gene that encodes a bood protein is: AUGACUCAUCGCUGUAGUUUACGA Consult the genetic code to answer the following questions: a. What is the sequence of amino...

Q:

There are 20,000 eligible voters in York County, South Carolina. A random sample of 500 York County voters revealed 350 plan to vote to return Louella Miller to the state senate. Construct a 99%...

Q:

__________________ is the most influential group of professional accountants in the United States and around the world. Group of answer choices GAAP IASB IFRS Foundation AICPA

Q:

7-8. The latest issue of a local business newspaper names 10 area executives who have exhibited excellent leadership skills in the past year. You are currently searching for a job, and a friend...

Q:

Perform a hypothesis test to compare the accuracy of the two tests, and report a two-sided p-value? A new test is proposed that may be better or worse than the standard test. To assess their relative...

Q:

Suppose the investigators plan a larger study comparing the two tests. How many infants need to be tested to have an 80% probability of finding a significant difference using a two-sided test with...

Q:

What is the difference between a nominal and ordinal categorical variable? What type of variable is ocular discomfort? Ophthalmology Dry eye is the most prevalent form of ocular discomfort and...

Q:

Xi Construction Inc. is in a 20% income tax bracket. The firm plans to invest more in net working capital of THB500 million, while its capital expenditures are projected to be THB1,600 million next...

Q:

Q1.Kebt Corporation's Class Semi bonds have a 12-year maturity and an 9.75% coupon paid semiannually (4.875% each 6 months), and those bonds sell at their $1,000 par value. The firm's Class Ann bonds...

Q:

According to your research, the growth rate in dividends for Manta Energy for the previous 1 0 years has been negative 1 3 percent. If investors feel this growth rate will continue, what is the...