The fact that DNA sequences are more similar in more closely related organisms is evidence of what?
Question:
The fact that DNA sequences are more similar in more closely related organisms is evidence of what?
a. Optimal design in organisms
b. Adaptation
c. Mutation
d. Descent with modification
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (12 reviews)
So when you analyze DNA and see the ...View the full answer
Answered By
Marvine Ekina
Marvine Ekina
Dedicated and experienced Academic Tutor with a proven track record for helping students to improve their academic performance. Adept at evaluating students and creating learning plans based on their strengths and weaknesses. Bringing forth a devotion to education and helping others to achieve their academic and life goals.
PERSONAL INFORMATION
Address: , ,
Nationality:
Driving License:
Hobbies: reading
SKILLS
????? Problem Solving Skills
????? Predictive Modeling
????? Customer Service Skills
????? Creative Problem Solving Skills
????? Strong Analytical Skills
????? Project Management Skills
????? Multitasking Skills
????? Leadership Skills
????? Curriculum Development
????? Excellent Communication Skills
????? SAT Prep
????? Knowledge of Educational Philosophies
????? Informal and Formal Assessments
0.00
0 Reviews
10+ Question Solved
Related Book For
Concepts Of Biology
ISBN: 9781938168116
1st Edition
Authors: Samantha Fowler, Rebecca Roush, James Wise
Question Posted:
Students also viewed these Life Sciences questions
-
Are individual stock returns more closely related to national or industry factors? What implication does this have for portfolio diversification?
-
In the pairs of DNA sequences below, the lower duplex represents a mutagenized daughter duplex. Identify the mutation as a transition, a transversion, an insertion, or a deletion. (a) (b) 5'...
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
A company has the following results for the three accounting periods to 31 March 2021: Assuming that all possible claims are made to relieve the trading loss against total profits, calculate the...
-
The costs of inspection for five product attributes A, B, C, D, and E are $10, $5, $4, $2, and $12, respectively. The cost of failure for each attribute is estimated to be $25 for A, $15 for B, $30...
-
The unadjusted trial balance of Global Enterprises for the year ended December 31, 2021, follows: Additional information: 1. There was $700 of supplies on hand on December 31, 2021. 2. Depreciation...
-
Patty Hayes owned four Personal Seat Licenses (PSLs) at the Cleveland Browns Stadium. Hayess PSLs reserved four seats on the 50-yard line, at the railing, on the north side of the stadium. As the...
-
Gold Nest Company of Guandong, China, is a family-owned enterprise that makes birdcages for the South China market. A popular pastime among older Chinese men is to take their pet birds on daily...
-
10. Label and explain in details the following diagram A 12. 1 Give three functions of E. Zinc E B + C D Copper 13. Give an ideal principle of predicting a performance of a fuel cell and give an...
-
Challenge exercise 02 c2b-1, brides receivables, inventory & services and companym0du/es 1 refer to exercise 2 open the 02 c2b-1 brides file and enter receivable transactions for may fora bridal...
-
Which situation would most likely lead to allopatric speciation? a. A flood causes the formation of a new lake. b. A storm causes several large trees to fall down. c. A mutation causes a new trait to...
-
The wing of a bird and the arm of a human are examples of ________. a. Vestigial structures b. Molecular structures c. Homologous structures d. Analogous structures
-
An executive's telephone log showed the following data for the length of 65 calls initiated during the last week of July. (a) Prepare a dot plot. (b) Prepare a frequency distribution and histogram...
-
Why are innovations like replacing the slow QWERTY keyboard with a faster one not adopted quickly despite their advantages? Can you think of other innovations that are available now but not yet...
-
How has free expression given creativity to the public domain in Australia?
-
10.2 A cable of length 5 m has a tension of 300 N. The cable weighs 3 N. Compute the propagation speed of any transverse disturbances in the cable.
-
What can Communication teach us about addressing some of the major global challenges we face?
-
write an elevator speech to justifies the need for a reasonable level of standardization across the master data management (MDM) processes.
-
In addition to the qualitative variable, use of ethics consultation in the future ("yes" or "no"), one of the quantitative variables measured in the survey of physicians was length of time in...
-
What is EBIT/eps analysis? What information does it provide managers?
-
RNA was extracted from TMV (tobacco mosaic virus) particles and found to contain 20 percent cytosine (20 percent of the bases were cytosine). With this information, is it possible to predict what...
-
DNA was extracted from cells of Staphylococcus afermentans and analyzed for base composition. It was found that 37 percent of the bases are cytosine. With this information, is it possible to predict...
-
If one strand of DNA in the WatsonCrick double helixhas a base sequence of 5-GTCATGAC-3, what is the base sequence of the complementary strand?
-
On January 1, 2019, Ivanhoe Company purchased equipment for $394000. The equipment is estimated to have a salvage value of $16000 and is being depreciated over eight years under the...
-
9. The risk-neutral process for the Constant Elasticity of Variance (CEV) model is: dSrSdt + Sad Z Assume you have a call option (V) that is a function of the spot (stock price S) and time (t), Ito...
-
Conduct a market survey based on your current experience/ education. the objective is to be able to answer the question' what are your salary expectations". 1- Identify your career goal - short term....
Study smarter with the SolutionInn App