From the following balances of M/s Nilu Sarees as on March 31, 2005. Prepare trading and profit
Question:
From the following balances of M/s Nilu Sarees as on March 31, 2005. Prepare trading and profit and loss account and balance sheet as on date.
Closing stock as on March 31, 2005 Rs.22,000.
Transcribed Image Text:
Account Title Opening stock Purchases Carriage inwards Salaries Commission Wages Rent & taxes Repairs Telephone expenses Legal charges Sundry expenses cash in hand Debtors Machinery Investments Drawings Debit Amount Rs. 10,000 78,000 2,500 30,000 10,000 11,000 2,800 5,000 1,400 1,500 2,500 12,000 30,000 60,000 90,000 18,000 Account Title Sales Capital Interest Commission Creditors Bills payable Credit Amount Rs. 2,28,000 70,000 7,000 8,000 28,000 2,370
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 100% (QA)
To prepare the trading and profit and loss account and balance sheet for Ms Nilu Sarees as of March ...View the full answer
Answered By
Charles mwangi
I am a postgraduate in chemistry (Industrial chemistry with management),with writing experience for more than 3 years.I have specialized in content development,questions,term papers and assignments.Majoring in chemistry,information science,management,human resource management,accounting,business law,marketing,psychology,excl expert ,education and engineering.I have tutored in other different platforms where my DNA includes three key aspects i.e,quality papers,timely and free from any academic malpractices.I frequently engage clients in each and every step to ensure quality service delivery.This is to ensure sustainability of the tutoring aspects as well as the credibility of the platform.
4.30+
2+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Business questions
-
Jim walks wearily down the street carrying an assault rifle and is wearing a belt loaded with ammunition. He walks up to a police officer and says, I hate cops. I hope to kill some one day. Jim is...
-
Hi, I need help with this accounting problem, thanks inadvance.l [The following information applies to the questions displayed below.] Delph Company uses a job-order costing system and has two...
-
Why is a new compensation plan needed at Mead, and what are the positive outcomes of a successful sales compensation plan?
-
Collins Corporation purchased office equipment at the beginning of 2022 and capitalized a cost of $2,000,000. This cost figure included the following expenditures: The company estimated an eight-year...
-
The time to prepare a slide for high-throughput genomics is a Poisson process with a mean of two hours per slide. What is the probability that 10 slides require more than 25 hours to prepare?
-
A tool used for fabricating semiconductor devices consists of a chuck (thick metallic, cylindrical disk) onto which a very thin silicon wafer (p = 2700 kg/m 3 c = 875 J/kg K, k = 177 W/m K) is...
-
A firm has 10,000,000 shares of common stock outstanding, each with a market price of $15.00 per share. It has 80,000 bonds outstanding, each selling for $1020. The bonds mature in 15 years, have a...
-
Prepare trading and profit and loss account of M/s Sports Equipments for the year ended March 31, 2006 and balance sheet as on that date : Closing stock as on March 31, 2006 Rs.2,500 Account Title...
-
Prepare trading and profit and loss account from the following particulars of M/s Neema Traders as on March 31, 2005. Stock on March 31, 2005 Rs.16,000. Account Title Buildings Plant Carriage inwards...
-
The sequence of a region of interest in a DNA template strand is 3ATACGACTAGTCGGGACCATATC5. If the primer in a dideoxy sequencing experiment anneals just to the left of this sequence, draw the...
-
You are a mid-level manager for a large accounting firm. Your task is to hire 20 new employees. Before execution, you must address the following items: Report to the district manager: Your plan to...
-
The gene for curled wings (C/c) is located nearly at the end of the long arm of chromosome 2 of Drosophila, while the gene for smooth abdomen (S/s) is nearly at the end of the short arm of the same...
-
Give at least 2 examples of conditioning from your own personal experience and state the conditioned stimulus and conditioned response in each of your examples. An example could be how your pet cat...
-
What makes a good staff? After reviewing the lectures for this week, what are steps you can take to train and develop your staff to provide the best customer service possible? Would you include...
-
A rock is thrown from a cliff top at 18 m/s, 25 degrees above the horizontal. It lands on the beach 4.2 seconds later. a) What is the height of the cliff? b) How far from the base of the cliff did...
-
Casper Corporation has collected the following information after its first year of sales. Net sales were $1,600,000 on 100,000 units; selling expenses $240,000 (40% variable and 60% fixed); direct...
-
If |62x|>9, which of the following is a possible value of x? A. 2 B. 1 C. 0 D. 4 E. 7
-
Define a liability and explain each part of the definition?
-
Define an asset and explain each part of the definition?
-
Define an asset and explain each part of the definition?
-
A small ball of mass M = 1 3 . 0 kg is attached to a simple pendulum hanging from a uniform string of mass m = 0 . 0 2 kg . The period of oscillations for the simple pendulum is 2 s . Determine the...
-
A wheel on Teresa's bicycle is 2.5ft in diameter. Teresa rides the bicycle in a race, and the wheel turns 46 times during the course of the race. How long is the race
-
The critical angle for a substance in air is measured at 53.7. If light enters this substance from air at 45.0 with the normal, at what angle with the normal will it continue to travel?
Study smarter with the SolutionInn App