The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation
Question:
The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
– GAUUCCUUUCGUCAGUCCGAGA –
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Related Book For
Fundamentals Of Biochemistry Life At The Molecular Level
ISBN: 9781118918401
5th Edition
Authors: Donald Voet, Judith G Voet, Charlotte W Pratt
Question Posted: