Consider the following diagram of a small open economy: a) Calculate net exports and the capital outflow

Question:

Consider the following diagram of a small open economy:

a) Calculate net exports and the capital outflow when the world real interest rate is 7%.

b) Calculate net exports and the capital outflow when the world real interest rate is 5%.

image text in transcribed

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Macroeconomics Policy And Practice

ISBN: 978-0133424317

2nd Edition

Authors: Frederic Mishkin

See More Books

Question Posted: Feb 17, 2024 11:01 PM

See More Questions

Use the properties of logarithms to express each logarithm as a sum or difference of logarithms, or as a single logarithm if possible. Assume that all variables represent positive real numbers. log4...
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
Selected data on merchandise inventory, purchases, and sales for Jaffe Co. and Coronado Co. are as follows: Instructions 1. Determine the estimated cost of the merchandise inventory of Jaffe Co. on...
Northcutt Bikes purchases two types of wheels for their road racing bikes: a regular version and a deluxe version. The table below has demand information for the past year for each style of wheel, as...
Determine the third Taylor polynomial of the given function at x = 0. f(x) = 5e 2x
Suppose that, for a sample size of $n=3$, you have $e_{2}=24$ and $e_{3}=-1$. Determine $e_{1}$.
Gerstner Corporation is authorized to issue 10,000 shares of $40 par value, 10% preferred stock and 200,000 shares of $5 par value common stock . On January 1, 2014, the ledger contained the...
Joint Cost Allocation Net Realizable Value Method Nature s Garden Inc. produces wood chips, wood pulp, and mulch. These products are produced through harvesting trees and sending the logs through a...
Consider a small open economy that is currently running a trade surplus. Answer the following questions using a graphical representation of desired saving and investment in the small open economy: a)...
Suppose Japan has a GDP of $5 trillion, and that its national savings rate is 25%. Assuming Japan is an open economy, a) calculate Japans investment if net exports are 1% of GDP. b) calculate Japans...
For a 2 x 2 linear DE system we can make a quick handsketch of the elliptical trajectories as follows. (a) All the elliptical trajectories are concentric and similar, so we can get all the key...
Two ropes are attached to a heavy box to pull it along the floor. One rope applies a force of 585 newtons in a direction due west; the other applies a force of 350 newtons in a direction due south....
Imagine you are attending a conference on psychotherapy. A therapist presents findings about a new form of therapy that has been developed and tested in a small sample of people. Patients' scores on...
The Hubble Space Telescope has a mirror diameter of 2.4 m. Suppose the telescope was used to photograph the surface of the moon from a distance of 3.510 8 m . What is the distance between two objects...
Explain how social impact theory influences your self-perception and self-esteem, how you compare yourself to others, and your willingness to conform and comply with others in everyday life and on...
How do emergent social movements challenge entrenched power structures and catalyze transformative societal shifts?
Rich Jackson, a recent finance graduate, is planning to go into the wholesale building supply business with his brother, Jim, who majored in building construction. The firm would sell primarily to...
Outline some of the major problems confronting an international advertiser.
From 2009 to 2011, the economies of Australia and Switzerland suffered relatively mild effects from the global financial crisis. At the same time, many countries in the euro area were hit hard by...
The zero-lower-bound on short-term interest rates is not a problem, since the central bank can just use quantitative easing to lower intermediate and longer term interest rates instead. Is this...
In a Treasury auction of $2.1 billion par value 91-day T-bills, the following bids were submitted: If only these competitive bids are received, who will receive T-bills, in what quantity, and at what...
In many cases, financial innovations are seen to be interesting twists on existing technologies and business models. Comment
How do you think a skilled investment manager could use alpha in building a portfolio for a client? What might be some red flags when using alpha that an investment manager should pay attention to...
Avocado plants takes two years to mature before they bear fruit. Peter Ip, an owner of an avocado farm, expects that it will produce $1000 in the third year, $1500 the year after, $2000 in the fifth...

Consider the following diagram of a small open economy: a) Calculate net exports and the capital outflow

Question:

Real Interest Rate, r 7% 5% 500 600 Saving Curve Investment Curve 1,000 1,100 Desired Saving and Investment (in billions of dollars)

Step by Step Answer:

Based on the diagramwe can analyze the impact of different world real interest rates on net exports ...View the full answer

Macroeconomics Policy And Practice

Students also viewed these Business questions