People may be busy and under pressure, but stress is far too much an overused word. stress
Question:
People may be busy and under pressure, but stress is far too much an overused word. stress has become something of a fashion and many people appear to compete for who is most stressed. The biggest danger is that the more people talk about stress, the more likely they will really become stressed. What are your honest views? Do you feel the need to talk about stress?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 50% (2 reviews)
The concept of stress is indeed prevalent in modern society and it is often discussed and sometimes even glorified However its important to approach t...View the full answer
Answered By
ANDREW KIPRUTO
Academic Writing Expert
I have over 7 years of research and application experience. I am trained and licensed to provide expertise in IT information, computer sciences related topics and other units like chemistry, Business, law, biology, biochemistry, and genetics. I'm a network and IT admin with +8 years of experience in all kind of environments.
I can help you in the following areas:
Networking
- Ethernet, Wireless Airmax and 802.11, fiber networks on GPON/GEPON and WDM
- Protocols and IP Services: VLANs, LACP, ACLs, VPNs, OSPF, BGP, RADIUS, PPPoE, DNS, Proxies, SNMP
- Vendors: MikroTik, Ubiquiti, Cisco, Juniper, HP, Dell, DrayTek, SMC, Zyxel, Furukawa Electric, and many more
- Monitoring Systems: PRTG, Zabbix, Whatsup Gold, TheDude, RRDtoo
Always available for new projects! Contact me for any inquiries
4.30+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Business questions
-
Planning is one of the most important management functions in any business. A front office managers first step in planning should involve determine the departments goals. Planning also includes...
-
Although DonorsChoose.org is a nonprofit organization, a charitable organization by most any standard, it operates as though it is a business, albeit a highly effective and efficient one. Much like...
-
Managing Scope Changes Case Study Scope changes on a project can occur regardless of how well the project is planned or executed. Scope changes can be the result of something that was omitted during...
-
In Exercises 2748, find the open intervals where the functions are concave upward or concave downward. Find any inflection points. f(x) = 2e x2
-
Give an application for a partitioned database.
-
Refer to the data in Exercise 13.33. (a) Use the Z test for testing the equality of two population proportions with a two-sided alternative. Verify the relation x2 = Z2 by comparing their numerical...
-
Consider a vapor condensing on a wall and forming a liquid film. Assume that locally the film thickness is related to the flow rate per unit transfer area by momentum-transfer considerations. Then...
-
1. Identify the main strategic issues facing ITV. 2. Suggest a number of strategic options that ITV might pursue. 3. Create tables to assess the SAFe of your strategic options (refer to Table 12.1)....
-
Selected current year-end financial statements of Cabot Corporation follow. (All sales were on credit; selected balance sheet amounts at December 31 of the prior year were inventory, $50,900; total...
-
Suggestions for coping with a high level of stress, for example adjusting your viewpoint, changing your job or relaxation therapy, may be well intended but are difficult to implement and have little...
-
Discuss whether you believe that stress is contagious and is influenced by the behaviour and actions of other people.
-
A student found an old bottle labeled thymol on the stockroom shelf. After noticing a pleasant odor, she obtained the following mass, IR, and NMR spectra. The NMR peak at 4.8 disappears on shaking...
-
Saying that a quantitative trait exhibits a continuum means that a. the numerical value for the trait increases with the age of the individual. b. environmental effects are additive. c. the...
-
The government has today imposed a price ceiling on gasoline purchased at the pump. As one member of Congress said, It was done to keep gasoline prices within the reach of the poor and the...
-
An antibiotic is a drug that kills or inhibits the growth of microorganisms. The use of antibiotics has been of great importance in the battle against many infectious diseases caused by...
-
With regard to the CRISPR-Cas system that defends bacteria against bacteriophage attack, what happens during the adaptation, expression, and interference phases? When a bacterium is exposed to a...
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
Data for Levine Inc. are given in E. In E, Levine Inc., which produces a single product, has prepared the following standard cost sheet for one unit of the product. Direct materials (8 pounds at...
-
Planning: Creating an Audience Profile; Collaboration: Team Projects. Compare the Facebook pages of three companies in the same industry. Analyze the content on all available tabs. What can you...
-
What do YOU believe are the greatest opportunities and risks from changing environmental influences that face business organisations today?
-
How far are YOU able to identify clearly with the shared values or mission statement of your university? Do you believe mission statements serve any useful purpose?
-
How would YOU explain the relationship between: (i) strategy and structure; (ii) strategy and culture?
-
Whitman Company has just completed its first year of operations. The company's traditional format income statement for the year follows: Whitman Company Income Statement Sales (35,000 units x $25 per...
-
Distinguish between Job Order Costing and Process Costing Describe and Identify the Three Major Components of Product Costs under Job Order Costing Use the Job Order Costing Method to Trace the...
-
Northern Illinois Manufacturing prepared the balance sheet and income statement for this year. Now the company needs to prepare its statement of cash flow. The comparative balance sheets for Northern...
Study smarter with the SolutionInn App