a. Which of the following DNA strands, the top or bottom, would serve as a template for

Question:

a. Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction?

5' ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3'

3 'TGCCTGACATGGCGACTTCAGT ACCTGCGAGCT 5'

→

Direction of DNA unwinding

b. What would be the resulting RNA sequence (written 5' to 3')?

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Molecular Cell Biology

ISBN: 978-1429234139

7th edition

Authors: Harvey Lodish, Arnold Berk, Chris A. Kaiser, Monty Krieger, Anthony Bretscher, Hidde Ploegh, Angelika Amon, Matthew P. Scott

See More Books

Question Posted: Apr 17, 2018 10:06 AM

See More Questions

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat, which breaks hydrogen bonds? A. GGCGTACCAGCGCAT CCGCATGGTCGCGTA B....
The stability of a DNA double helix can be measured by its melting temperature, Tm, defined as the temperature at which the helix is 50% dissociated into individual chains. Which of the following...
Which of the following statements are true about molecular markers? A. All molecular markers are segments of DNA that carry specific genes. B. A molecular marker is a segment of DNA that is found at...
Relationship of the Balanced Scorecard to activity-based costing Explain how an activity-based costing model can be linked to a Balanced Scorecard approach.
Write a paper on Stress management, use the link immediately below this section to read an article about the long term impact of stress and complete the Holmes and RAHE Stress Scale. Report your...
A company maintains its non-current assets at cost. A separate accumulated depreciation account is used for each type of asset. Machinery is to be depreciated at the rate of 15% per annum, and...
Does object-oriented technology help or hinder testing?
Success Systems' second quarter 2014 fixed budget performance report for its computer furniture operations follows. The $156,000 budgeted expenses include $108,000 in variable expenses for desks and...
Describe the shape of the distribution for the histograms below: Frequency 10 20 30 Histogram of Protein 2 Protein 6 Mean = 2.53 Std. Dev. 1.089 N = 76
1. Work up a buying plan to use when buying from Ghuman's. 2. How should Hughes distribute the allotted open-to-buy dollars among the available sizes, colors, and fabrics? Synopsis: A department...
The genome of a retrovirus can integrate into the host-cell genome. What gene is unique to retroviruses, and why is the protein encoded by this gene absolutely necessary for maintaining the...
Contrast prokaryotic and eukaryotic gene characteristics.
How much money did the Rajus earn from sales of Satyam stock in the eight years preceding the fraud revelation?
What kind of working capital policy does the company use? By the way here is the link for the financial statement for the year 2020 and 2019:...
(a) Cactus Sdn. Bhd. has no debt outstanding and a total market value of RM150,000. Earnings before interest and taxes, EBIT, are projected to be RM25,000 if economic conditions are normal. If there...
You estimated the single index (market) model for stocks A and B with the following results: Return on Stock A: RA = 0.04 +0.5RM + eA Return on Stock B: RB = -0.02 +1.5R + eB where RM is return on...
A company plans to launch two mutually exclusive projects and requires rate of return of 12 %. The cost and expected cash flows from both projects are as follow. YEAR 0 1 2 3 Tesola model X (50,000)...
Suppose that the exchange rate for U.S. $1 for another currency is such that U.S. $1 = 3.5 ARS (Argentine pesos). Further suppose that if the exchange rate remains the same, you will receive a 25%...
The following limits equal the derivative of a function f at a point a. a. Find one possible f and a. b. Evaluate the limit. V3 cos (7 + h) lim |h0 2
Find the intercepts and then graph the line. (a) 2x - 3y = 6 (b) 10 - 5x = 2y
For the two adaptations listed, attach an image of an organism with this feature that is thought to have existed during the Carboniferous. Write what type of organism it is and explain why the...
During the Carboniferous, forests grew to unprecedented heights. Describe one adaptation in plants that would account for this dramatic change.
Studies have shown there are major differences in types of organisms inhabiting different areas of the Bay. How do the data you recorded in Table 8.2 help to explain this finding?
I need to find out how to calculate the 3-year % rate of return. The information I have is a $10,000 investment and a 12-month yield percentage (1.138 for AB company, 1.894 for AIG company, 0.679 for...
Anna has an investment that will bring her $100 with a 30% probability and $40 with a 70% probability. Anna's Utility function is U = Y (1/2) . Where Y= income. Anna is considering selling this...
on January 1, 2000, the price of koka kola was $10. on jan and, 2020, the shares were worth $100. the stock Paid no dividends during the period. what is the annual geometric return.

a. Which of the following DNA strands, the top or bottom, would serve as a template for

Question:

Step by Step Answer:

a Bottom s...View the full answer

Molecular Cell Biology

Students also viewed these Life Sciences questions