A segment of DNA in E. coli has the following sequence of nucleotide pairs: When this segment
Question:
When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?
Transcribed Image Text:
3'-A ACTGTACGTGCTACCTTGCTGATATTACT- TII!!|!||||||||||||||||I|I!|||| 5'-TİGACATGĊAĊGÁTĠGAÁCĠACTATÁÁTGA- GCAATGGGCTGTATCGATGCȚẠCTGCTAT-5' TII|||||||TI|||||||||T||||||| CGTTAČČČGÁČÁŤÁGČŤÁČGÁTGÁČGÁŤÁ-3'
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 72% (11 reviews)
Given the consensus 35 and 10 sequences in ...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Principles of Genetics
ISBN: 978-1119142287
7th edition
Authors: D. Peter Snustad, Michael J. Simmons
Question Posted:
Students also viewed these Life Sciences questions
-
A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are in the segment? How many uracil residues are in the segment?
-
A segment of DNA has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence immediately after reaction with nitrous acid? Let the letters H represent hypoxanthine and U...
-
A segment of DNA is put in place and stretched. Figure P7.82 shows a graph of the force exerted on the DNA as a function of the displacement of the stage. Based on this graph, which statement is the...
-
A palindrome is a string that is the same backward as it is forward. For example,tot and otto are rather short palindromes. Write a program that lets a user enter a string and that passes to a bool...
-
In Example 4.21 on page 194, we discussed randomly selecting, without replacement, two students from Professor Weiss's introductory statistics class. Suppose now that three students are selected...
-
Balm, Inc., has a general business credit for 2016 of $90,000. Balm's regular income tax liability before credits is $140,000, and its tentative AMT is $132,000. a. Calculate the amount of general...
-
Assume that the current measurements in a strip of wire follow a normal distribution with a mean of 10 milliamperes and a variance of 4 (milliamperes) \({ }^{2}\). What is the probability that a...
-
Julio is in the 33% tax bracket. He acquired 2,000 shares of stock in Gray Corporation seven years ago at a cost of $50 per share. In the current year, Julio received a payment of $150,000 from Gray...
-
Given the following information, and using the VC method of valuation, determine the % of the company that needs to be given up for $1.5 m investment. Required ROR by investor(s): 25% Net income in...
-
Allie has bought a new apple orchard. The orchard has a single file of trees, numbered from 1 to N. Each tree has a certail number of ripe apples. Allie has a rule she wants to follow. She wants to...
-
A segment of DNA in E. coli has the following sequence of nucleotide pairs: When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?...
-
A segment of human DNA has the following sequence of nucleotide pairs: When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?...
-
(a) Write 4 3/2 = 8 in logarithmic form. (b) Write log 8 4 = 2/3 in exponential form.
-
Watch the TED Talk . Using your readings this week as a guide, apply what you've learned in the text by answering the following discussion questions (include references to textbook whenever...
-
Firm-Stakeholder Relationship Pick a firm-stakeholder relationship that you care about and Why do you care about this firm-stakeholder relationship? Then On the B Corp website, identify a B Corp firm...
-
Based on the IHRM analysis, the following recommendations are made to improve the effectiveness of Pfizer's performance management practices in the global context ( explain 1-5 in detail ) : 1....
-
The Great Resignation watch this video https://www.youtube.com/watch?v=YoTLc_MObhI(Links to an external site.) You work for the HR department for the fast food industry and hospitality, you need to...
-
Consider the information below about AusAid APAC 01 project and advise how the project links to the Aplha Med organisation strategic direction Alpha Med strategic direction - To reinvent the way...
-
A common type of viscosimeter for liquids consists of a relatively large reservoir with a very slender outlet tube, the rate of outflow being determined by timing the fall in the surface level. If...
-
What mass of KBr (in grams) should you use to make 350.0 mL of a 1.30 M KBr solution?
-
Once cells have differentiated to their final specialized forms, they never again alter expression of their genes. Is the statement true? Explain why or why not.
-
CG islands are thought to have arisen during evolution because they were associated with portions of the genome that remained unmethylated in the germ line. Is the statement true? Explain why or why...
-
In most differentiated tissues, daughter cells retain a memory of gene expression patterns that were present in the parent cell through mechanisms that do not involve changes in the sequence of their...
-
A farmer wonders if his crops grow better in sun or in shade. He measures the amount of fruit gathered from a sample of 50 trees growing in full sun and from a sample of 50 trees growing in mostly...
-
Consider the diagram. Determine the length of AC to the nearest cm. Determine the length of DC to the nearest cm. 28 38 A 224 cm 789 B
-
Use this picture to answer the following questions. 10 18 16. 3 AB=10 AC=16 AD=22 AE=15 BC-17 BD=18 15 BE=25 CD=26 CE=8 DE=11 Find the Nearest Neighbor Circuit for each vertex. Also give the weight...
Study smarter with the SolutionInn App