Question: A single-stranded template is properly base paired with a short primer as shown below. Assume that there is a 3'0H end in the correct place.

A single-stranded template is properly base paired with a short primer as shown below. Assume that there is a 3'0H end in the correct place. If DNA polymerase and dNTPs are added, how long will the top strand be after the enzyme has synthesized as much as it is able to? (Hint: Pay attention to the polarity of the template strand.) TTTTT GTTCT ACCGTCCAAGACCTTCAGTA | | . . . . . . .

5 bases (no synthesis occurs)
9 bases
14 bases
11 bases
6 bases

TTTTT GTTCT ACCGTCCAAGACCTTCAGTA | | . . . . . . . . . . . . . . . . . 5' 3'

Step by Step Solution

★★★★★

3.46 Rating (153 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

To solve this question we need to determine how far DNA polymerase will synthesize along the templat... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

A dog training business began on December 1. The following transactions occurred during its first month. December 1 Receives $33,000 cash as an owner investment in exchange for common stock. December...

The ability of DNA polymerase to digest a DNA strand from one end is called its exonuclease activity. Exonuclease activity is used to digest RNA primers and also to proofread a newly made DNA strand....

A DNA template plus primer with the structure (where P = a phosphate group) is placed in an in vitro DNA synthesis system (Mg 2+ , an excess of the four deoxyribonucleoside triphosphates, etc.)...

DNA synthesized using RNA as a template is known as cDNA. In the technique called subtractive hybridization cloning, small amounts of cDNA from all the mRNA of tissue A is hybridized to all the RNA...

Please scan the SEC Plain English that I've attached. Please visit to this link.http://www.sec.gov/Archives/edgar/data/320193/000119312513416534/d590790d10k.htm#toc590790_9 Please read pages 25...

Need help with this assignment.I've attached the excel workbook that should be used to record answers and the case scenario. The case discusses the dilemma of the CFO of PSUWC Energy LLC, an energy...

BME 201 HOMEWORK 5 - How to fix the code for DNA Replication, Transcription, and translation. InsulinDNAseq is included. Please help! 0 10f7 BME 201 Homework 5 - Molecular Biology: Transcription and...

Chapter 3 Describe and explain the terms climate sensitivity, fat tail, and low beta, and how they relate to climate change. What are the estimated economic costs of global warming? Can we trust...

MACY'S FINAL REPORT VJ Thomas, Amber Bowden, Megan Sozio Fangdi Hou Product Development Professor James Gutman April 26, 2016 2 Table of Contents Target Market Report...

I need chapters 18, 19, 20, and 21 for the workbook for Personal Finance by Madura!! Please help!!! Personal Finance, Fifth Edition by Jeff Madura BUILDING YOUR OWN FINANCIAL PLAN WORKBOOK INDEX...

will require integrating human resource management theory and thought (as described in the textbook) while addressing major issues in the field and therefore will require proper referencing and...

The danger of "growing broke" (versus going broke) in the context of rapid sales growth. At first glance, this might seem a bit counterintuitive - i.e., isn't fast growth a good thing? Why can it...

Find a devil's pair for the test that checks the degree sequence in two graphs to make sure they agree.

What determines company success and failure in the AI era? This is the central question in strategic management today ( see course learning objectives 1 , 2 , & 3 ) . All companies face similar...

Introduction The SAP system is an enterprise resource planning system that aids in the execution of key business functions within an organisation. The SAP system is compromised with many different...

a. Prepare the adjusting entry required to update the inventory and related accounts at December 31. Update the affected accounts. (List all debit entries before credit entries. Credit account titles...

Star Bank has a P 10,000,000 loan to Estrella Realty, which was invested by the latter in real estate development. Due to the economic downtrend in the real estate business, Estrella Realty is...

Some elements of the income statement of XYZ Limited are provided below: J F M J J O N D 80 88 112 136 128 272 184 128 96 96 88 120 Sales k Cost of Sales k TALENT A M Arden Assessment dai 72 A 40 44...

Clippy Company was incorporated on January 1, 2020, it has 8,000 shares of common stock and 2,000 shares of non- cumulative preferred stock with 11% dividend rate and $70 par value. Clippy Company...

14 Not yet answered Marked out of 1.00 Flag question Question text Which of the following is prohibited under competition law? Question 14Answer a. Branding b. Strategic partnerships c. Abuse of...

I'm looking for a full case solution on the case: Pelarsen Windows Humans vs. Robots. I've attached the full case. Please let me know, as i'd highly appreciate your help here. ISSN 1940-204X Pelarsen...

Do you know how to find the cost pools for the Pelarsen Windows: Humans v. Robots? ISSN 1940-204X Pelarsen Windows: Humans v. Robots1 Shahid Ansari Babson College Paul Mulligan Babson College Alfred...

The excel homework assignment below has five tabs that cover five different topics: Net Present Value Analysis, Capital Budgeting and Cost of Capital, Working Capital, Management, Financial Ratio...

Scenario and Assignment Details Elon Motors produces electric automobiles. In recent years, they have been making all components of the cars, excluding the batteries for each vehicle. The company's...

Its your first day of your auditing internship with a public accounting firm and you have been asked to look over a clients statement of cash flows to determine if things have been appropriately...

Elon Motors produces electric automobiles. In recent years, they have been making all components of the cars, excluding the batteries for each vehicle. The company's leadership team has been...