# $1)$ Write a function that checks whether a given word or number is palindrome or not

# and returns True if it is palindrome and False if it is not palindrome.

def is$\_$palindrome$($word$)$:

pass # remove this line and comment and replace it with the code needed for the main function.

# write a function that computes the length of a DNA sequence and the proportion of individual bases in the sequences

# Note that: the function must return the four values inorder of $,$ DNA$\_$sequence$\_$length, base$\_$A$\_$proportion,

# base$\_$T$\_$proportion, base$\_$C$\_$proportion and base$\_$G$\_$proportion.

def dna$\_$nucleotide$($text$)$:

pass # remove this line and comment and replace it with the code needed for the main function.

def main$()$:

word $=$ input$("$ Please enter a word : $")$

# uncomment the following lines to test your is$\_$palindrome$()$ function

# if is$\_$palindrome$($word$)$:

# print$($f$"\{$word$\}$ is palindrome!"$)$

# else:

# print$($f$"\{$word$\}$ is not palindrome!"$)$

print$()$

txt $=$ input$("$ Please enter a DNA sequence: $")$

# uncomment the following lines to test your dna$\_$nucleotide$()$ function

# dna$\_$length, base$\_$A$\_$prop, base$\_$T$\_$prop, base$\_$C$\_$prop, base$\_$G$\_$prop $=$ dna$\_$nucleotide$($txt$)$

# print$($f$"$ DNA sequence length $=\{$dna$\_$length$\}")$

# print$($f$"$ Base A proportion $=\{$base$\_$A$\_$prop:$\mathrm{.}2$f$\}\%")$

# print$($f$"$ Base T proportion $=\{$base$\_$T$\_$prop:$\mathrm{.}2$f$\}\%")$

# print$($f$"$ Base C proportion $=\{$base$\_$C$\_$prop:$\mathrm{.}2$f$\}\%")$

# print$($f$"$ Base G proportion $=\{$base$\_$G$\_$prop:$\mathrm{.}2$f$\}\%")$

if $\_\_$name$\_\_==\text{'}\_\_$main$\_\_\text{'}$:

main$()$ using Assignment Requirements

For this assignment, you need to commplete the following two problems as described below and based on the starter code

Problem $1$: A palindrome is a word or number that reads the same backward or forward.

Example:

$$ palindrome number: $121,252,16461,...$

$$ palindrome word: racecar, civic, madam, $...$

Write a python function to check if a given string is palindrome or not. Your function is name is$\_$palindrome $($word$).$ The function returns true if the given word is palindrome $,$ false otherwise.

Problem $2$ : Given a DNA nucleotide seqences, for instance:

DNA$=$"ATGCGCGGATCGTACCTAATCGATGGCATTAGCCGAGCCCGATTACGC"

Write a python program that computes the length of the sequence and the proportion of individual bases in the sequence. That is percentage of A$($A$\%),$ percentage of T $($T$\%,),$ percentage of C $($C$\%)$ and percentage of G$($ G$\%).$

The function name is dna$\_$nucleotide $($text$)$ and it returns five values such as dna$\_$length, base$\_$A$\_$proportion, base$\_$T$\_$proportion, base$\_$C$\_$proportion and base$\_$G$\_$proportion respectively. The text can be given in lower case or uppercase. Your code must work in both cases. Thus, consider converting the given text to upper case. There are only four bases $($A$,$T$,$C and G$)$ in DNA sequence.

Note that:

base$\_$A$\_$proportion$($percentage of A $)=($number of letter A in the text$)/($total length of the text$)$

Similarly, you can compute for percentage of T $,$ percentage of C and percentage of G$."""$

this was my written code and there are still test fails can you please fix it

# $1)$ Write a function that checks whether a given word or number is palindrome or not

# and returns True if it is palindrome and False if it is not palindrome.

def is$\_$palindrome$($word$)$:

word $=$ word.lower$()$

return word $==$ word$[$::$-1]$

# write a function that computes the length of a DNA sequence and the proportion of individual bases in the sequences

# Note that: the function must return the four values inorder of $,$ DNA$\_$sequence$\_$length, base$\_$A$\_$proportion,

# base$\_$T$\_$proportion, base$\_$C$\_$proportion and base$\_$G$\_$proportion.

def dna$\_$nucleotide$($text$)$:

text $=$ text.upper$()$

dna$\_$length $=$ leng$($text$)$

count$\_$A $=$ text.count$(\text{'}$A$\text{'})$

count$\_$T $=$ text.count$(\text{'}$T$\text{'})$

count$\_$C $=$ text.count$(\text{'}$C$\text{'})$

count$\_$G $=$ text.count$(\text{'}$G$\text{'})$

if dna$\_$length $==0$:

return dna$\_$length, $0,0,0,0$

prop$\_$A $=($count$\_$A $/$ dna$\_$length$)*100$

prop$\_$T $=($count$\_$T $/$ dna$\_$length$)*100$

prop$\_$C $=($count$\_$C $/$ dna$\_$length$)*100$

prop$\_$G $=($count$\_$G $/$ dna$\_$length$)*100$

return dna$\_$length, prop$\_$A$,$ prop$\_$T$,$ prop$\_$C$,$ prop$\_$G

def main$()$:

word $=$ input$("$ Please enter a word : $")$

if is$\_$palindrome$($word$)$:

print$($f$"$

$\{$word$\}$ is palindrome!"$)$

else:

print$($f$"$

$\{$word$\}$ is not palindrome!"$)$

txt $=$ input$("$

Please enter a DNA sequence: $")$

dna$\_$length, base$\_$A$\_$prop, base$\_$T$\_$prop, base$\_$C$\_$prop

print$($f$"$

DNA sequence length $=\{$dna$\_$length$\}")$

print$($f$"$Base A proportion $=\{$base$\_$A$\_$prop:$\mathrm{.}2$f$\}\%")$

print$($f$"$Base T proportion $=\{$base$\_$T$\_$prop:$\mathrm{.}2$f$\}\%")$

print$($f$"$Base C proportion $=\{$base$\_$C$\_$prop:$\mathrm{.}2$f$\}\%")$

print$($f$"$Base G proportion $=\{$base$\_$G$\_$prop:$\mathrm{.}2$f$\}\%")$

if $\_\_$name$\_\_==\text{'}\_\_$main$\_\_\text{'}$:

main$()$