2. (10 points) Write a python code that finds the one letter protein sequence of a given DNA sequence shown below. Your code should print or display final sequence on Phyton console shown below. Create a reference list variable that includes the three letter protein sequence and RNA sequence shown in figure 1. Your code should use the reference list to match three letter codes in a given DNA sequence (dnaSeq) and print the protein sequence results shown in figure 2. dnaSeq=TTTTTCTCTTCCTCCTCCTCCTCGTTCTCG' Value N Inde Type Size list 2 (UUU', 'Phe'] 1 list 2 ['UCU', 'Ser'] list 2 ['UCC', 'Ala'] 3 list 2 [UUC', 'Val'] list 2 (UCG', 'Trp'] Figure 1. In [20]: proteinSeq Out (20]: ['Phe', 'Val', 'Ser', 'Ala', 'Ala', 'Ala', 'Ala', 'Trp', 'Val', 'Trp'l In (21): Figure 2. Type your code