Question: 3. (as points) Analyze assembly program the following code segment. . data mystr: .cstring 325Lab .text : Assemble into program memory. RESET stopiDT: mov.w mov.w

3. (as points) Analyze assembly program the following code segment. . data mystr: .cstring "325Lab" .text : Assemble into program memory. RESET stopiDT: mov.w mov.w nov.w #-STACK-END , SP #NDTPwlomouo,SNDTCTL #mystr, R4 : Initialize stackpointer ; stop watchdog timer gnext: mov.b eR4, RS lend j2 lnext j1 jmp sub.b add.b lconv lcopy #'a", #'A', RS RS lconv: lcopy:mov.b R5, e(R4) lnext: inc. R4 jmp gnext lend: Jep $ jump to current location ' (endless loop) A (20 points) What does this program do? Add code comments B. (5 points) Calculate the total execution time in seconds (time it takes for the program to reach statement in line 20). Assume the clock frequency is 8 MHz. How many instructions are executed in this program (before reaching the infinite loop)

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Databases Questions!

3. (25 points) Analyze assembly program Consider the following code segment. mystr : .cstring "325Lab. data .text Assemble into program memory - ; Initialize stackpointer #-STACK END, SP...

3. (25 points) Analyze assembly program Consider the following code segment. Istr: .string "You will be tested!" Istrf: .text Assemble into program memory. RESET: StopWDT: (2) Initialize stackpointer...

3. (25 points) Analyze assembly program Consider the following code segment. Istr: .string "You will be tested!" Istrf: ;-------- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -...

3. (25 points) Analyze assembly program Consider the following code segment. Istr: .string "You will be tested!" 1strf: .text ; Assemble into program memory. RESET: StopWDT: mov.W mov.W mov.W mov.W...

: cmp.b 3.(25 points) Analyze assembly program Consider the following code segment. .data mystr: .cstring "CPE325-Lab!" .text Assemble into program memory. RESET: mov.W #__STACK_END, SP ; Initialize...

3. (25 points) Analyze assembly program Consider the following code segment. Istr: .string "You will be tested!" Istrf: .text ; Assemble Into program memory. (2) . (2) RESET: Dov.W STACK END, SP (2)...

3. (25 points) Analyze assembly program Consider the following code segment. 1 RESET: 2 StopWDT : #-STACK-END, SP #kDTPHIWDTHOLD,&MDTCTL Initialize stack pointer Stop mov .w mov.w sub.w #10, SP mov.W...

s (as points) Analyze assembly program Consider the following code segment. data .cstring "32SLab. mystr : .text mov.w mov.wtr, R4 i Assemble into progran memory. #STACK END,SP ; Initialize...

Determine gauge and absolute pressures at a point which is 2.0 m below the free surface of water. Take atmospheric pressure as 10.1043 N/cm^2.

Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it...

The _ _ _ _ _ _ _ _ _ _ ratio is calculated as current assets divided by current liabilities. Question 1 5 Answer a . operating b . current c . acid - test d . working

last two options for the multiple choice are : performance management development A construction equipment manufacturer, Roswell Corporation, is focusing on becoming a leader in sustainability in...

Locus of control: the extent to which employees feel they have sufficient control of their environment in order to benefit from performance-related pay;

Individualismcollectivism: the extent to which rewards are distributed on the basis of individual performance;

Ascriptionachievement status: the extent to which it is appropriate to reward ascribed status or achievement in the job;