Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
Initial DNA sequence 3 GCCATTACTGAGGATCGGAАТТСAGCTCTТАСАТTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it into its corresponding protein fragment. Don't forget to look for start and stop codons! Protein fragment= 2. Referring to the original DNA strand below, change the 11th base from adenine to cytosine to mimic a mismatch mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAATTCAGCTCTTACATTGCA5' mRNA= protein fragment= What happened? 3. Referring to the original DNA strand below, insert thymine between the 10th and 11th base to mimic an insertion mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAАТТСАGCTCTТАСАТTGCA5' mRNA= protein fragmentD What happened? Initial DNA sequence 3 GCCATTACTGAGGATCGGAАТТСAGCTCTТАСАТTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it into its corresponding protein fragment. Don't forget to look for start and stop codons! Protein fragment= 2. Referring to the original DNA strand below, change the 11th base from adenine to cytosine to mimic a mismatch mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAATTCAGCTCTTACATTGCA5' mRNA= protein fragment= What happened? 3. Referring to the original DNA strand below, insert thymine between the 10th and 11th base to mimic an insertion mutation. Initial DNA sequence 3' GCCATTACTGAGGATCGGAАТТСАGCTCTТАСАТTGCA5' mRNA= protein fragmentD What happened?
Expert Answer:
Answer rating: 100% (QA)
1 Initial DNA sequence 3 GCCATTACTGAGGATCGGAATTCAGCTCTTACATTGCA 5 MRNA sequence 5 CGGUAAUG ACU CCU A... View the full answer
Related Book For
Posted Date:
Students also viewed these accounting questions
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
The change of a single base in the DNA sequence for normal hemoglobin can encode for the abnormal hemoglobin, giving rise to sickle cell anemia. Which base in the codon for glu in DNA is replaced to...
-
DNA (deoxyribonucleic acid) is made from a sequence of four nucleotides (A, T, G, or C). Suppose a region of DNA is 40 nucleotides long. How many possible nucleotide sequences are there in this...
-
You are analyzing HUE stock. You expect that the dividends over the next three years will be $1.75 in year 1, $1.90 in year 2, $2.00 in year 3 and that HUEs stock price will be $46.32. What is the...
-
What is the primary difference between a time-series model and an associative model?
-
The Medassist Pharmaceutical Company conducted a study to determine whether a drug affects eye movements. A standardized scale was developed, and the drug was administered to one group, while a...
-
Below are selected data from Microsoft's recent financial statements: Required Calculate the following ratios for 2017 and 2016 and comment on the trend: a. Current ratio b. Quick ratio Net income...
-
Epworth Co. predicts that it will use 360,000 gallons of material during the year. It anticipates that it will cost $72 to place each order. The annual carrying cost is $4 per gallon. a. Determine...
-
Sunland's Auto Care is considering the purchase of a new tow truck. The garage doesn't currently have a tow truck, and the $60,050 price tag for a new truck would represent a major expenditure....
-
Whitestone Company produces two subassemblies, JR-14 and RM-13, used in manufacturing trucks. The company is currently using an absorption costing system that applies overhead based on direct-labor...
-
Management of Blossom, a biotech firm, forecasted the following growth rates for the next three years: 35 percent, 28 percent, and 22 percent. Management then expects the company to grow at a...
-
Following 9/11, the U.S. government created legal reforms, policies, and regulations related to homeland security. What are they? Are they still responding to the "needs" of homeland security...
-
Given an input integer n, followed by n additional input integers for an array, write an algorithm in Coral that will find the sum of all the negative odd integers in the array. Below is a...
-
Identify, define and discuss each of the following. Contract Offer Cause Counter offer Contractual Capacity Fraud Consideration Detrimental reliance Statute of frauds Suspensive Condition Essay....
-
The Ford Haven complex consists of forty studio, eighty one-bedroom apartments and eighty two- bedroom apartments. All rental leases for units have a fixed twelve-month term. Beginning today, which...
-
Develop a sorting algorithm. Your sorting algorithm may only be an implementation of a the shellsort, mergesort, or quicksort. Your algorithm must use an array of integers of at least 20 different...
-
What do the initially empty stacks stack and stack2 "look like" after the following sequence of operation Compare these results with Self-Test Exercise 2.
-
Subprime loans have higher loss rates than many other types of loans. Explain why lenders offer subprime loans. Describe the characteristics of the typical borrower in a subprime consumer loan.
-
What are the expected phenotypic ratios from the following cross: Tt Rryy Aa x Tt rr YY Aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal; T, j R,...
-
What is the phenomenon of RNA interference (RNAi)? During RNAi, explain how the double-stranded RNA is processed and how it leads to the silencing of a complementary mRNA.
-
Bacillus thuringiensis makes toxins that kill insects. This toxin must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one...
-
The following are selected transactions for Tyler, Inc., for 2017 and 2018. The firm closes its books on December 31. 2017 Dec. 31 Issued \($500,000\) of 12 percent, ten-year bonds for...
-
Magee Company reports the following in its current year financial statements: Compute the following ratios for Magee Company: a. Current ratio b. Quick ratio c. Times-interest-earned ratio Current...
-
For each of the following scenarios determine if the firm should (a) record as a liability; (b) disclose The solution is on as a contingent liability; or (c) neither: 1. The Seco Co. has been sued by...
Study smarter with the SolutionInn App