Question: 4. Functional genomics and experimental design: Design an experiment to discover all the genes in Saccharomyces cerevisiae that encode proteins that are essential for sporulation.

4. Functional genomics and experimental design:

Design an experiment to discover all the genes in Saccharomyces cerevisiae that encode proteins that are essential for sporulation. Discuss any difficulties or constraints you envision with your approach.

Modify the experiment to discover genes encoding proteins that are needed for sporulation, but for which there maybe functional redundancy. Discuss any further difficulties.

Figure A

organism 2 --ATA--------------------------------------------------------- CAGCTCTTCTGA--AATGTAT–TGAA 163

organism 3 --TTGG---------------------------------------------- ATTGCAGCTCTICTGA—AATGCAT–TGAA 163

organism 6 GATTGA -------------------------------------------------------- TTAGCAGCTCTTCTGA—AATGCAT–TGAA 163

organism 5 GATTGAAGTCAGAGATTACTCTCTGATGAATTAGCAGCTCTTCTGA--AATGCAT–TGAA 163
organism 4 –GA--------------------------------------------- TTAGCAGCTCTTCTGA--AATGCAT–TGAA 163

organism 1 ---CGC --------------------------------------------------------- CCGCCGGCCGAGCGTAGTAGTTTACATGAA 163

* ** * * * * * ****

organism2 ATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTT 223 organism3 ATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTT 223 organism 6 ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT 223 organism 5 ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT 223 organism4 ATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTT 223 organism1 ATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATT 223

******** ********************************* ************* **

organism 2 GCGCCCT–TTGG--------------------------------------- CTTTGCCTTCTCTTGAAGAG—AGATAACTATGC 266

organism 3 GCGCCCT–TTGGTACTICACGGCTCCCTTTGTGITCTCTCCTAGGG—AGATACCTATGC 280

organism 6 GCGCTCC–TTGG----------------------------------------- TATTCC----GAGGA--GCATGCCTGTTT 257

organism 5 GCGCTCCACCCGC---------------------------------------- TGAACT----TAAGC--ATATCAATAAGC 259

organism 4 GCGCCCT–TTGGCA--------------------------------------- TTCCGACCTCAAATCGGGTGAGACTACCCGCT 268

organism 1 GCGCCCG–CCAGTA--------------------------------------- TTAAAAGCCTTATTTTACCCAAGGTTGACCT–C 268

**** *

Step by Step Solution

★★★★★

3.54 Rating (151 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

The given question is complex and involves designing experiments in genomics Heres a detailed approach to tackle the problem step by step Experiment t... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

During the Christmas break of his final year at the University of Florida (U of F), Aaron Barnes plans to put together his rsum in order to seek full-time employment as a software engineer during the...

Design of an experiment to verify the f vs. Re chart for spheres, it is desired to design an experiment to test the friction factor chart in Fig. 6.3-1 for flow around a sphere. Specifically, we want...

As a stock analyst, discuss any difficulties or inadequacies that you might find with the financial statements of a company that is predominantly a research and development firm.

The promoters on genes encoding early proteins in viruses like T4 have a different sequence than the promoters on genes encoding late proteins in the same virus. Explain how this benefits the virus.

Reflection & Refraction AIM The aim is to evaluate the laws of reflection and refraction by direct measurements. We will use a ruler and a protractor to trace the paths of light rays (lasers) through...

\fMarketing Fashion: A Global Perspective 00_INT_Rath_FM_FNL.indd 1 4/16/12 6:54 PM 00_INT_Rath_FM_FNL.indd 2 4/16/12 6:54 PM Marketing Fashion: A Global Perspective Patricia Mink Rath Marketing...

Question 2: The file P02_35.xlsx contains data from a survey of 500 randomly selected households. Use Excel filters to answer the following questions. a) Compute the following for all homeowners...

CASE 1 : ZARA Source: Based on: Zara: Taking the Lead in Fast - Fashion, Rachel Tiplady, BusinessweekOnline, April 4 , 2 0 0 6 . Zara is the flagship brand of the Spanish retail group, Inditex, one...

\f \f11TH EDITION STRATEGIC MANAGEMENT THEORY 11TH EDITION Strategic Management THEORY Charles W. L. Hill University of Washington - Foster School of Business Gareth R. Jones Melissa A. Schilling New...

BACKGROUND Samsung C&T is the parent organization of Samsung Group. Byung-Chull Lee, the originator, laid out Samsung Sanghoe in 1938, opening another section in its set of experiences. Cheil...

CoursHeroTranscribedText: Quantitative Techniques for Business Project School of Economics and Finance Curtin University Felix Chan July 25, 2016 1 Introduction The aim of this project is to evaluate...

Use the data in the given table to create a scatter-plot. Use the scatter-plot to choose the most appropriate regression model, then fill in the missing coefficients. Round your answers to 3 decimal...

Consider the curves defined by y = x - e* and x = 1. Find the intersection point of the two curves. = 2%. y=x-ex X= 29 24 y = 2% e y= 0 X= 1 29 = X 2 lny = x Iny = x/2 y=e* 2. Write the two curves...

Question 1 3 ( 1 point ) Find the slope of the tangent to the curve y = x x 1 l n x at the point ( 1 , 1 ) . - 1 1 1 2 0

Gnap (1995) conducted a survey to estimate the teacher workload in Maricopa County, Arizona, public school districts. Her target population was all first through sixth grade full-time public school...

Gnap (1995) conducted a survey on teacher workload which was used in Exercise 15 of Chapter 5. a. The original survey was intended as a one-stage cluster sample. What was the overall response rate?...

1. What are the strengths and weaknesses of the Campbell Soup Company's marketing information system? 2. What objectives does Campbell have for the marketing research efforts described in this case?...

Calculate the cash dividend paid per share for each of the firms in the following table using their earnings per share and dividend payoutratio: Company Dividend Payout Ratio Earnings per Share...

Which statement is true about wage and price stickiness in Keynesian economics? Select the best answer. in market-onented economies, there is no obvious way to coordinate wage reductions during...

Q1 - Title of Study (No more than 15 words ) Q2- Choose 5 keywords that describe this study Q3- Abstract (100 - 150 words ) , The abstracts should include the following: i) aim, ii) methodology, iii)...

1. Using examples from the case study critically examine the 5 forces which establish the rivalry in the global pharmaceutical industry. 2. Using examples from the case study critically examine the...

is the last step in obtaining the sequence of a genome A. find the overlap between large pieces B. Break the DNA molecules C. Read the sequence D. find the overlap between small pieces is the first...

.is the study of heredity A. Genomics B. Genetics C. Genetic Engineering D. Paleogenomics . the analysis of the information content of entire genomes. A. Genomics B. Genetics C. Genetic Engineering...

Genomics is the study of biological processes from the perspective of the whole genome. Genomics includes several specific areas of study. Identify the type of genomics employed in each of the...

Bioinformatic tools are used for: OA) Structural Genomics B) Functional Genomics C) Evolutionary or Comparative Genomics OD) All of the above E) B&C