4. The following transactions occurred during 2020: a. Axis Oil Company and Alan Oil Company jointly...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
4. The following transactions occurred during 2020: a. Axis Oil Company and Alan Oil Company jointly purchased a 1,500-acre lease in Oklahoma for $48,000. Axis has a 55% WI and Alan has a 45% WI. Axis will be the operator of the lease. b. Brady Oil Company owns 100% WI in a lease (with a 1/5 royalty interest), with capitalized costs of $500,000. Brady assigns the working interest to Fugate Oil for $900,000 and keeps an 18% overriding royalty interest. c. Brady Oil Company owns 100% WI in a lease (with a 1/7 royalty interest) in Oklahoma and transfers a 1/15 overriding royalty interest to the controller of the company. d. Bruce Oil Company owns the working interest in a lease in Nueces County, Texas and assigns 45% of the working interest to the Larson Oil Company in return for Larson drilling and equipping a well on the property. After the well is completed, Bruce and Larson will share revenues and costs. e. Larson Oil Company assigns the working interest in Lease A to Bruce Oil Company for $800,000. In return, Larson will receive 20,000 barrels of oil from the first 30% of Bruce's production. f. Bruce Oil Company sells a production payment interest of 5,000 barrels of oil for $500,000, which is to be paid from the first 30% of production. g. Everit Oil Company owns a working interest in Harris County, Texas. Everit transfers 55% of the working interest to Stephens Oil Company in exchange for Stephens bearing all costs of drilling, completing, and operating the property until payout. Stephens Oil Company will receive 100% of the working interest's share of revenue until drilling and developing costs have been recovered, at which time the property will be operated as a joint property. REQUIRED: Identify the types of interests created by the 2020 transactions. If the interest is an overriding royalty or a production payment interest, also state whether it is a retained or carved-out interest. with Farmer Brown, the owner 4. The following transactions occurred during 2020: a. Axis Oil Company and Alan Oil Company jointly purchased a 1,500-acre lease in Oklahoma for $48,000. Axis has a 55% WI and Alan has a 45% WI. Axis will be the operator of the lease. b. Brady Oil Company owns 100% WI in a lease (with a 1/5 royalty interest), with capitalized costs of $500,000. Brady assigns the working interest to Fugate Oil for $900,000 and keeps an 18% overriding royalty interest. c. Brady Oil Company owns 100% WI in a lease (with a 1/7 royalty interest) in Oklahoma and transfers a 1/15 overriding royalty interest to the controller of the company. d. Bruce Oil Company owns the working interest in a lease in Nueces County, Texas and assigns 45% of the working interest to the Larson Oil Company in return for Larson drilling and equipping a well on the property. After the well is completed, Bruce and Larson will share revenues and costs. e. Larson Oil Company assigns the working interest in Lease A to Bruce Oil Company for $800,000. In return, Larson will receive 20,000 barrels of oil from the first 30% of Bruce's production. f. Bruce Oil Company sells a production payment interest of 5,000 barrels of oil for $500,000, which is to be paid from the first 30% of production. g. Everit Oil Company owns a working interest in Harris County, Texas. Everit transfers 55% of the working interest to Stephens Oil Company in exchange for Stephens bearing all costs of drilling, completing, and operating the property until payout. Stephens Oil Company will receive 100% of the working interest's share of revenue until drilling and developing costs have been recovered, at which time the property will be operated as a joint property. REQUIRED: Identify the types of interests created by the 2020 transactions. If the interest is an overriding royalty or a production payment interest, also state whether it is a retained or carved-out interest. with Farmer Brown, the owner
Expert Answer:
Answer rating: 100% (QA)
a Working interest b Overriding royalty interest retained c Overriding royalty interest carvedout d ... View the full answer
Related Book For
Intermediate Accounting
ISBN: 978-0077400163
6th edition
Authors: J. David Spiceland, James Sepe, Mark Nelson
Posted Date:
Students also viewed these accounting questions
-
The following transactions occurred during 2012. Assume that depreciation of 10% per year is charged on all machinery and 3% per year on buildings, on a straight-line basis, with no estimated salvage...
-
The following transactions occurred during MP Public Relations Firms first month of business: a. Marlene and Pamela opened up MP Public Relations Firm by contributing $22,750 on July 1, 2009, in...
-
The following transactions occurred during the year: a. Common stock was issued in exchange for a new heavy truck. b. A cash dividend of $20,000 was paid. c. A 90-day note payable was issued for...
-
A particle of mass m moves in a certain plane P due to a force F whose magnitude is constant and whose vector rotates in that plane with a constant angular velocity . Assuming the particle to be...
-
Sonya, who is single, owns 20,000 shares of Malthouse Corporation stock. She acquired the stock in 2008 for $75,000. On August 12, 2011, Sonyas father tells her of a rumor that Malthouse will file...
-
Debate which of the following persons can give a valid consent to search a: A highly intoxicated person? B: A five-year-old? C: A twelve-year-old child? D: A mentally retarded or senile person? E: An...
-
Do larger butterflies live longer? The wingspan (in millimeters) and the lifespan in the adult state (in days) were measured for 22 species of butterfly. Following are the results. a. Compute the...
-
The following table contains a partial list of countries, the continents on which they are located, and their respective gross domestic products (GDP) in U.S. dollars. A list of 125 countries and...
-
On December 31, 2022, Ditka Incorporated had Retained Earnings of $278,800 before Its closing entries were prepared and posted. During 2022, the company had service revenue of $179,100 and Interest...
-
Factory work can be boring and monotonous. Employees must work at the pace of the assembly line or machine, with output levels closely prescribed and monitored by management. It is not surprising...
-
The intrinsic value of a company is the present value of its expected future free cash flows (FCF) discounted at the weighted average cost of capital (WACC). How does one measure a firms risk and the...
-
An office building has 200 occupants, each of whom uses 3.5 gallons of hot water per day for 250 days each year. The temperature of the water as it enters the heater is 55F (an annual average). The...
-
Determine the annual evaporative losses from a 3,500-ft2 indoor swimming pool with indoor conditions of 78F and 60 percent relative humidity (RH). The water temperature is kept at 85F throughout the...
-
Ask individuals how they have used technology (email, Facebook, wikis, Twitter, and so forth) as supplements to face-to-face meetings. In what ways do these technologies help or impede group...
-
List all the groups to which you belong. Be sure to include family groups, friendship and other social groups, activity groups, committees, work teams, athletic teams, classroom groups, study groups,...
-
Assess the cost-effectiveness of a roof retrofit using a SIS for a Golden, CO, house that has an overall BLC of 400 W/C and roof insulated with RSI-5.9 with an exposed area of 180 m 2 . Estimate the...
-
2. Write a Python function in a Google Colab notebook that translates the given RNA sequence, AUGGGCGGAUACCCCUUAUUG, to its corresponding amino acid sequence based on the codon chart below. Describe...
-
A bar of a steel alloy that exhibits the stress-strain behavior shown in Figure 6.22 is subjected to a tensile load; the specimen is 375 mm (14.8 in.) long and has a square cross section 5.5 mm (0.22...
-
Explain how to estimate the average cost of inventory when using the retail inventory method.
-
Askew Company uses a periodic inventory system. The June 30, 2011, year-end trial balance for the company contained the following information: In addition, you determine that the June 30, 2011,...
-
Early in its fiscal year ending December 31, 2011, San Antonio Outfitters finalized plans to expand operations. The first stage was completed on March 28 with the purchase of a tract of land on the...
-
The table below lists the patients seen last month at Community Hospital with their age and cholesterol reading. Create a table using common age categories and these ranges for cholesterol. Community...
-
Decide whether the following statements have a positive or negative correlation: 1. Positive correlation 2. Negative correlation a. b. c d. e. People who suffer from depression have higher rates of...
-
1. Indicate whether a table or a graph is the preferred method of presentation in the following situations: a. Distribution by site, sex, race, and time period of all cancers in your healthcare...
Study smarter with the SolutionInn App