2. Write a Python function in a Google Colab notebook that translates the given RNA sequence, AUGGGCGGAUACCCCUUAUUG, to its corresponding amino acid sequence based on the codon chart below. Describe what each line of your function does. You can submit either a link to the notebook, or download and attach it to this assignment. First letter A G U UUU Phe UUC. UUA UUG}Leu CUU CUC CUA CUG Leu AUU AUC lle AUA AUG Met GUU GUC GUA GUG Val Second letter C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser -Pro -Thr - Ala A UAU UAC Tyr UGU UGC. UAA Stop UGA Stop A UAG Stop UGG Trp CAU U CGU CGC CGA CAGGIn CGG CAC. His AAC } Asn AAA -Lys AAG GAU GACJ G -Asp GAA GAG} Glu GU} -Cys GGU GGC GGA GGG Arg AGU AGC Ser AGA Arg AGG. SCAG Gly UCAG MCAG SCAG U Third letter