Question: 9:14 Done api.playposit.com 2 C Correct! Smart breeder: breeds most productive cows- 120L Selection differential (S): average of individuals selected to breed - average of

9:14 Done api.playposit.com 2 C Correct! Smart breeder: breeds most productive cows- 120L Selection differential (S): average of individuals selected to breed - average of On average F1 produces whole population 120-80 = 40L 100L Response to selection (R)= If heritability was 100% then 100L-80L = 20L response to selection should be h2=R/S 40L... but because some variation is environmental: h2=20/40 -0.5 IZOL CC Once you have calculated heritability, if the next generation (averaging 35cm in height) you select individuals that are 20cm tall to breed, what is the expected height of your F2 generation? ~10cm O ~5cm O ~30cm ~25cm SUBMIT 46:40 1:10:55

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock blur-text-image

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Mathematics Questions!

Please read attached and Critique: Write critique of the paper. Do you agree with the author that statistics is important? Why? Feel free to provide your own examples of a valuable statistical study....

9:21 Done api.playposit.com 2 C n 10 CC CRISPRCas system can be used to modify genes in other ways than cutting it. What needs to be done before you perform any of these other changes? Add an...

9:03 Done api.playposit.com 2 C Human genome project . It took 15 years - Sanger method 1988 1905 1999 2001 2003 AATCCG TAGG Today: more methods = cheaper Fluorescent Next gen sequencing - Illumina...

8:59 Done api.playposit.com 2 C DNA amplification = PCR (polymerase chain reaction) . Using a special heat tolerant Polymerase (Taq polymerase) . Denature double strand and add ingredients. . Repeat...

fill in blanks 9:47 .Ill 5GE Done api.playposit.com 2 C DNA polymerase 30.. .... P... . 80 joc yg Play YOUR GENOME CC DNA has to be fill in blank to fill in blank degrees for the two strands of DNA...

9:44 . 5G Done api.playposit.com 2 C yg YOUR GENOME 10 CC What other technology allows to amplify a copy of DNA that you want to sequence? O Restriction enzymes Polymerase Chain Reaction O CrisprCas9...

8:22 all 5G Done api.playposit.com 2 C Replic. D O Book 10 10 CC Which is the molecule that stores genetic information in cells? Sperm O Egg O DNA Proteins O RNA SUBMIT 04:39 1:00:33

which is correct t 9:28 Done api.playposit.com 2 C Reading frame TACCTGATGAAGGGACTAGCTAGTCGATCGGA CC How many possible reading frames are there in a MRNA sequence? O 1 O 3 O 0 4 SUBMIT 26:46 41:49

************** Please help if you could somehow do this i will definitely rate, Thank you ****************** Hampton Machine Tool Company The questions for the Hampton Machine Tool Company are given...

this 8:084 .1 5G+ Done api.playposit.com C CC Negative inducible operons are by default O turned on O Turned off SUBMIT 22:21 50:57 V

Johan's trial balance at 30 September 2022 is as shown below: Capital at 1 October 2021 Stock at 1 October 2021 Accounts receivable Accounts payable and accruals Bank Sales Returns inward Purchases...

A steam turbine with rated capacity of 56.4 MW operates with steam at inlet conditions of 8.6 MPa and 500 o C, and discharges into a condenser at a pressure of 10kPa. Assuming a turbine efficiency of...

Huixin standing at B is flying a kite. The kite is vertically above A. The string BK of length 120 m, attached to the kite, makes an angle of 53" to the horizontal. Assuming the string is taut, find...

You are the boss now the tables are turned you are the boss, and you are sending one of your team overseas to manage the new office. How do you select which employee should manage the new office?...