A biologist reached out to you for help. She has a DNA sequence. See below: input.dna <- "ATGGCAAAAGGAAATATCAATGTATCGGTGGAAAATATTTTCCCGCTTATCAAAAAGTTTCTTTACAGT" She needs help to convert this DNA sequence with 69 letters to amino acid sequence (a process called translation). A DNA sequence is a sequence of letters that contains only four types letters A,T,C and G. A protein sequence is a seuqnce of letters that contains 20 different letters. When converting DNA sequence into protein sequence, every three letters in DNA sequence specifies a particular amino acid (triplet code, see image below). genetic_code_table.jpg In this question, you need to to identify appropriate function(s) in the "seqinr" package and translate the input DNA sequence into amino acid. Your result vector should be of length 23 (69 / 3), the first letter in the vector should be "M" (translate from "ATG"). Write the R code for this