Question: please amswer only D to H PLEASE HELP ME YOU WILL SAVE MY SEMESTER i need help with this question i reposted again. ther eis

please amswer only D to H PLEASE HELP ME YOU WILL
please amswer only D to H PLEASE HELP ME YOU WILL
please amswer only D to H PLEASE HELP ME YOU WILL
please amswer only D to H PLEASE HELP ME YOU WILL SAVE MY SEMESTER i need help with this question i reposted again. ther eis no DATA OR MORE INFORMATION TO BE ADDED i did posted diferent question.
please amswer only D to H PLEASE HELP ME YOU WILL
please amswer only D to H PLEASE HELP ME YOU WILL
E. Total O (TC) BI 20.06 16E406 19 10E+06 9 unt 5.0E+05 2.0E+05 0.0E+00 0.0E+00 10E+05 3.0E-05 Number of Bottles (n) (0) Revenue ...Proposal Proposal B (hp) (a) At 160,000 parts, which of the following statements is true concerning Proposal I Select (b) Which statement is true at 300,000 parts? Select 1 (c) If Proposal A can make 15,000 parts per month, and Proposal B can make 10,000 parts per month, which of the following statements best describes the relationship? Select) (d) If the sales price is increased by $0.75 per part and all other variables remain the same, what will happen to the breakeven point for Proposal B? Select) 3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)If an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material Grant enzyme a US DNA, ones to one or mostranos connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material X X! X E. Total O (TC) BI 20.06 16E406 19 10E+06 9 unt 5.0E+05 2.0E+05 0.0E+00 0.0E+00 10E+05 3.0E-05 Number of Bottles (n) (0) Revenue ...Proposal Proposal B (hp) (a) At 160,000 parts, which of the following statements is true concerning Proposal I Select (b) Which statement is true at 300,000 parts? Select 1 (c) If Proposal A can make 15,000 parts per month, and Proposal B can make 10,000 parts per month, which of the following statements best describes the relationship? Select) (d) If the sales price is increased by $0.75 per part and all other variables remain the same, what will happen to the breakeven point for Proposal B? Select) 3. DNA is a polymer that is a chain composed of multiple monomers. By convention, we write the chemical formula of the polymer sequence in shorthand notation, where each monomer is represented by a letter. Consider the DNA sequence: ATATGACGATTGATATCCGGGATACT (A) How many distinct types of monomer units are in this polymer? (B) Considering the ordering of the monomers, what is this type of polymer called? (C) We can use a sequencing machine to artificially construct any DNA sequence we want, such as this: AAAAATTTTTAAAAATTTTTAAAAATTTTTAAAAATTTTTTAAAAA What type of polymer would this be? (D) You rationally engineer DNA nanostructures and nanocrystals in the lab. You find that when you measure the mechanical properties along one direction of the crystal it has a different response than along the opposite direction. What do you call a material when the measured properties are different along different crystal directions? (E) You melt the DNA crystal by raising the temperature and let the crystal reform at a higher temperature than you formed the initial crystal. This new crystal has a different structure. What is this called when a material that has been processed differently has different structures? What does the fact that the different structures preferentially form at different temperatures indicate? (F) You can engineer beams of DNA (see below) and construct structural elements, where the beams are "pre-stressed", or constructed with built in stresses. What kind of stresses do the beams experience if they have forces acting perpendicular to their cross-sectional area? (G)If an enzyme that cuts DNA, binds to one of the strands connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material Grant enzyme a US DNA, ones to one or mostranos connecting the beams, what mechanical stress would the construct experience? (H) If you apply a tensile load perpendicular to one face of cylindrical DNA structure, and it increases in dimension in the perpendicular direction, what do you know about the Poisson's ratio of this material? Explain how the behavior compares with a typical material X X! X

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related General Management Questions!