Question: A mutation in the coding strand ( non - template strand ) of a DNA sequence converts the codon 5 ' - CCT - 3

A mutation in the coding strand (non-template strand) of a DNA sequence converts the codon 5'-CCT-3' to 5'-CCG-3'. What type of mutation has been made?

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

Help me out with these questions :) 1. During transcription, the strand of DNA that base pairs with the new mRNA is called the: A. Non-template strand B. Parental strand C. Coding strand D. Template...

Q:

Please use pictures to see the tables as reference Part 1: Transcription and Translation Transcribe the following DNA sequence from HbA. Record your answer in Data Table 1. to submit for grading....

Q:

Proteins are synthesized with a particular amino acid sequence through the translation of information encoded in messenger RNA by an RNAprotein complex called a ribosome. Amino acids are specified by...

Q:

please try to answer parts 3,7&8 especially using python 2.7. my code is not working and this is due today. verify using working test codes. Basically I am stuck with the longestORF non reading (part...

Q:

1 2 pts ) You have induced mutations in a gene encoding an enzyme involved in yeast cellular respiration. The wild - type or normal DNA, RNA, and protein sequence is shown below. Then you are asked...

Q:

Examine the Figure below. The letters A to D represent a mutation in the DNA sequence. Specifically they represent a deletion of 2 nucleotides in the DNA sequence. Which of the mutations (A-D) will...

Q:

Transcription begins at the A ) Promoter B ) Start codon C ) transcription start site ( labeled + 1 in the figure ) Which direction does transcription progress? A ) 5 ' - 3 ' B ) 3 ' - 5 ' C )...

Q:

Draw a double stranded DNA in ladder form with the sequence TTACGATGCCTTAGGACA. A ) Identify the start and stop codon contained in this sequence. B ) Based on the sequence, assign a "template strand"...

Q:

A double - stranded piece of DNA is shown below. Informational ( coding ) strand of DNA: 5 ' - GC ATG AGG CGA CGT TAA CGG - 3 ' Template strand of DNA: 3 ' - CG TAC TCC GCT GCA ATT GCC - 5 ' What is...

Q:

5"CTAGCGGGTAAGGTTTTAGGGGATTATACACGAATCCCAGGCGATGTCAAGGGGCTCCAAAAGGAGCCTTT 3 3' GATCGCCCATTCCARAATCCCCTTGTGCTTAGGGTCCGC.E....CCCCGAGGTTTTCCTCGGAAA For the prokaryotic DNA sequence above, which strand...

Q:

How can it make good business sense to pay employees more than the law and the market require? In 2010, during very difficult economic times, the Hobby Lobby retail chain with 455 stores in 36 states...

Q:

Galambos Corporation had an average receivables collection period of 19 days in 2003. Galambos has stated that it wants to decrease its collection period in 2004 to match the industry average of 15...

Q:

Clauses included in homeownership deed that indicate who could or could not purchase the home are called Question 1 5 options: redlining blockbusting restrictive covenants. blind covenants.

Q:

Tyler Jackson owns 100 percent of the common shares of Piper Ltd. Tyler's shares have an adjusted cost base of $1,050,000. The Piper common shares have a total PUC of $1,610,000 and a total fair...