AGGTATCGCAT is a sequence from the coding strand of gene. What will be the corresponding sequence of

Fantastic news! We've Found the answer you've been seeking!

Question:

AGGTATCGCAT is a sequence from the coding strand of gene. What will be the corresponding sequence of the transcribed mRNA

(a) ACCUAUGCGAU

(b) AGGUAUCGCAU

(d) UGGTUTCGCAT

Related Book For answer-question

Genetics Analysis And Principles

ISBN: 9780073525341

5th Edition

Authors: Robert Brooker

See More Books

Posted Date: Dec 29, 2022 05:54 AM

See More Questions

A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
The sequence of the sense strand of a mammalian gene is...
A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species that degrades trinitrotoluene (TNT). The student is frustrated to find that the organism does not...
The following items were shown on the balance sheet of Herman Corporation on December 31, 2010: Stockholders Equity Paid-In Capital Capital Stock Common stock , $5 par value, 360,000 shares...
At a recent meeting, the president and the CEO of Production, Inc. got into a heated argument about whether or not to shut down the companys plant in Flint, Michigan. The plant currently loses...
A POAM is used to track the progress of a project. What type of chart is commonly used to assist with tracking? A. Fishbone chart B. Cause and effect chart C. Gantt chart D. POAM chart
In Hartnell governor, the compression of the spring as compared to lift of the sleeve is: (a) More (b) Less (c) Same (d) None of these
Lloyd Industries manufactures electrical equipment from specifications received from customers. Job X10 was for 1,000 motors to be used in a specially designed electrical complex. The following costs...
Sample Company Account Question You are provided with the trial balance of Twirl Ltd. as at 31st December 2019: Bank 78,000 Ordinary shares at 1 each Retained earnings at 1st January 2019 216,000...
You are planning a meeting with a new Audit client, Oscars Limited in respect of their audit coming up shortly. The company recently converted to a company from a partnership and has its year end as...
Discuss the characteristics of project phases?
During linear increase, TCP computes an increment to the congestion window as Explain why computing this increment each time an ACK arrives may not result in the correct increment. Give a more...
Get the WSDL for some SOAP-style Web Service and choose an operation. In the messages that implement that operation, identify the fields.
The POP3 Post Office Protocol only allows a client to retrieve email, using a password for authentication. Traditionally, to send email, a client would simply send it to its server and expect that it...
If a complex infrastructural project has been implemented in three different phases with three different financing decisions, would you carry out three different ex-post CBA for each of the phases or...
What is the difference between sensitivity and risk analysis?
SPG is currently trading at $125/share. You sold 10 PUT-option contracts on SPG with a strike price of $115 for $8 each: a. What will be your total $ and % gain/loss if SPG price is $135 at the...
Decades after the event, Johnson & Johnson (J&J), the 130-year-old American multinational, is still praised for swiftly The company indicated that its response was based on the expectations set forth...
Describe the key events during meiosis that result in a 50% reduction in the amount of genetic material per cell.
What are the roles of the core histone proteins compared with the role of histone HI in the compaction of eukaryotic DNA?
Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are three different mechanisms that turn off the expression of genes and gene products. Which of these...
In a large office building, there is a woman dead in her locked office, sitting at her desk. Except for the desk, chair, and contents on the desk, the office is empty and the air conditioner is...
How many birthdays does the average person have?
There are 5 different color houses, occupied by people of 5 different nationalities, who smoke 5 different cigar brands, drink 5 different types of alcohol, and have 5 different pets. The houses are...

AGGTATCGCAT is a sequence from the coding strand of gene. What will be the corresponding sequence of

Question:

Expert Answer:

The detailed answer for the above question is ... View the full answer

Genetics Analysis And Principles

Students also viewed these biology questions