Question: AGGTATCGCAT is a sequence from the coding strand of gene. What will be the corresponding sequence of the transcribed mRNA (a) ACCUAUGCGAU (b) AGGUAUCGCAU (c)

AGGTATCGCAT is a sequence from the coding strand of gene. What will be the corresponding sequence of the transcribed mRNA

(a) ACCUAUGCGAU

(b) AGGUAUCGCAU

(c) UCCAUAGCGUA

(d) UGGTUTCGCAT

Step by Step Solution

★★★★★

3.38 Rating (154 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

The detailed answer for the above question is ... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Biology Questions!

Q:

A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-

Q:

The sequence of the sense strand of a mammalian gene is...

Q:

A graduate student is trying to identify the gene coding for an enzyme found in a bacterial species that degrades trinitrotoluene (TNT). The student is frustrated to find that the organism does not...

Q:

Problem 1 (15 points) You are given the following DNA sequence, which is believed to contain a small protein-coding gene. GGAGGCGTAA AATGCGTACT GGTAATGCAA ACTAATGG If this sequence is fully...

Q:

Help me out with these questions :) 1. During transcription, the strand of DNA that base pairs with the new mRNA is called the: A. Non-template strand B. Parental strand C. Coding strand D. Template...

Q:

1 2 pts ) You have induced mutations in a gene encoding an enzyme involved in yeast cellular respiration. The wild - type or normal DNA, RNA, and protein sequence is shown below. Then you are asked...

Q:

What is the sociological perspective on race?

Q:

E9-15 (Algo) Computing a Present Value Involving an Annuity and a Single Payment LO 9-7 An investment will pay $16,300 at the end of each year for eight years and a one-time payment of $163,000 at...

Q:

xercise 3 # The gene GALK1 in human encodes the enzyme galactokinase 1. This enzyme enables the body to process a simple sugar called galactose, which is present in small amounts in many foods....

Q:

3) Two researchers, Ann and Malcolm, want to understand the biomechanical mechanism of the froghopper jump. Using photographs from a high-speed camera, each scientist sets their own coordinate system...

Q:

Consider the following data showing the initial rate of a reaction (A?products) at several different concentrations of A. [A](M) Initial Rate (M/s) 0.15 0.009 0.30 0.018 0.60 0.037 1.Estimate the...

Q:

Calculate the pH and concentration of all species in a 0.27 M [math]Na_2so_3[/math] (sodium sulfite) solution? The ionization constants for sulfurous acid are (math]K_{al} = 1.4 x 10^{-2}{/math] and...

Q:

Find the slope ( m ) of the line that passes through the given points. ( - 5 , 4 ) and ( 2 , 4 )

Q:

CASE STUDY You work at Connect Skills Real Estate Pty Ltd at 888 Scott Street Epping. Licence #: 1789L Part of your job is to manage the company's trust account. You have recently been on an extended...

Q:

The finance director for the City of Green Falls printed the General Fund Revenues and Appropriations Ledgers shown below for the year just ended. The beginning-of-the-year fund balance was $160,160....

Q:

A. Voltage Measurements at 90 Hz Turn on your function generator. It defaults to a sine wave with a frequency of 1000 Hz. Set the Frequency to 90.000 Hz by using the decade buttons (below 100.000) to...

Q:

Eve agrees to sell her boutique to Shelley for $150,000. Shelley spends $60,000 on inventory and fixtures for the store, but then Eve repudiates the contract. Shelley is able to sell the inventory...

Q:

This is not a project and/or assignment for marks, as theses are textbook questions, and will not be copying the tutors work/answers. Please answer all the questions in the space provided and in full...

Q:

Researchers want to examine if there is an association between the amount of a hair growth medication and the length of the hair (inches). There is a random sample of 75 participants. An alpha of...

Q:

Describe the key events during meiosis that result in a 50% reduction in the amount of genetic material per cell.

Q:

What are the roles of the core histone proteins compared with the role of histone HI in the compaction of eukaryotic DNA?

Q:

Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are three different mechanisms that turn off the expression of genes and gene products. Which of these...

Q:

John Rawls is a philosopher famous for his maxi-min principle, which states that society should maximize the position of the people with the mini-mum amount of goods, and not focus only on the level...

Q:

Consider Table 21P-7, which shows several different types of goods sold in a hypothetical town. Imagine a new competitor enters who refuses to discriminate between locals and foreigners in hiring...

Q:

The left column of Table 21P-4 shows the income data for 10 people at age 40. The right column shows the income for one of their children at the same age (adjusted for inflation). a. How many people...